Answer:
I think the ans is B a cup of black coffee
Answer:
A cup of black coffee
Explanation: You have to stir the ingredients in until they dissolve
helpppp I’ll do anything BUT I HATE links so please NO links
Mitochondria: source of energy to cell
Nucleus: contains dna and controls center
Ribosomes: produces protein
Cell membrane: gives protection
answer and show proof for brainliest
Answer:
C- South America. Because South America is mostly rain forest and forests in the northern and mid section of it.
Explanation:
Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver
Answer:
The pancreas
Explanation:
it happens when the pancreas doesnt produce enough of something called insulin
how does a liver cell respond to insulin
Answer:
Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.
Explanation:
Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.
Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.
Answer:
Liver phosphorylase a concentration decreases when glucose enters the blood.
The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form
As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form
Explanation:
Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.
Which of the following fresh water biomes consists of moving water
Answer:
Biomes consists of moving water is estuaries.
What is the formula to find out the energy when given the energy?
Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree
Answer:
D
Explanation:
The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria
How can a small mutation provide a small advantage to an organism?
Answer:
It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.
Hope this helps!
Describe the steps a plant would take to move sugars from a source to a sink.
Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids
Answer:
The correct answer is - proteins.
Explanation:
All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.
Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.
What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%
Answer:
90%
Explanation:
What is the major distinction scientists use to divide the animal kingdom?
Answer:
Whether the animal has a vertebral column or not.
What are examples of convections currents? What are examples of convection currents? A: the movement of war air into cooler air and cooler air into warmer air B: the movement of cool water into warmer water and warmer water into cool water. C: the displacement of air/water molecules by other air/water molecules due to varying temperatures. D: all of the above
Answer:
C: the displacement of air/water molecules by other air/water molecules due to varying temperatures
I need help ASAP!!
A.D
B.B
C.C
D.A
Answer:
a ibecause tifmsndtbeekodfhekekn
As a discussed in the lesson, eukaryotic cels are differ from prokaryotic cells based on what three things?
Answer:
Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions
Please help, A, B,C, or D?
Answer:
I cant see the pic??
Explanation:
in developing countries, which of the following is predicted to happen to both population and demand for meat and milk?
A. it will double by 2050
B. it will decrease by 2050
C. it will stay the same in 2050
D. it will increase slightly by 2050
what does the tilde symbol mean in biology
Answer:
means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".
extrusive rocks have larger grains than intrusive rocks.true or false and why
False because extrusive rocks have fine-grained texture due to the rapid cooling of magna above the earth surface. On the other hand extrusive rocks have course grained texture due to slow cooling of magna beneath the Earth's surface
Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks
Answer:
Bacteria
Explanation:
Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.
Sunlight, rocks, and soil are all non-living.
The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.
They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.
Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.
Learn more about soil at:
https://brainly.com/question/31227835
#SPJ6
Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA
Answer:
The correct answer is -
a single strand with a distinctive cloverleaf structure, and
tRNA
Explanation:
The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.
Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.
the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles
Both Mrs. Smith and Mrs. Jones had babies the same day in the same hospital. Mrs. Smith took home a baby girl named Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect, however, that her baby had been accidently been switched with the Smith baby in the nursery. Blood tests were made. Mr. Smith was blood type A, Mrs. Smith was type B, Mr. Jones was type A, Mrs. Jones was type A. Shirley was type O, and Jane was type B. Had a mix-up occurred? SHOW WORK!
Answer:
yes a mixup had occured because two A blood types would result in a baby with the same blood unle mr.jones wasnt the father
Explanation:
How many hydrogen bonds are present in the base pairing of guanine and cytosine?
3
Answer:
3 Hydrogen bonds
Explanation:
Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds.
How do invasive species usually affect the availability of natural resources in an ecosystem?
PLEASE HELP ME
Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.
Explanation:
You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele
Answer:
Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )
Explanation:
The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.
The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ). hence option D is the correct answer.
In pea plants, purple flowers (P) are dominant over white flowers (P). If two heterozygous purple flowered plants are
crossed with each other, then what are the possible genotypes of the offspring?
0
Answer is pp only
Answer :the answer is D
Explanation:
The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it
Answer:
A) make new cells(somatic cells)and only germ-line cells do it(meiosis)
Explanation:
Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.
While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.
Meiosis produces germ cells while mitosis produces somatic cells.
Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.
The research practices Mendel used is applies including A, B and C.
What is Mendel's experiment?
Mendel studied inheritance in peas (Pisum sativum). He chose peas because pea plant are easy to grow and can be sown each year. Pea flowers contain both male and female parts, called stamen and stigma, and can usually self-pollinate.
Mendel studied the inheritance of 7 traits in pea plants including height, flower color, seed color, and seed shape and each trait had 2 forms. He identified pure-breeding pea plants that consistently showed 1 form of a trait after generations of self-pollination.
Mendel proposed a theory of inheritance, based upon the observed data during his experiments, and a mathematical analysis of his results,
Thus, from above, the correct options include A, B and C whereas D doesnt apply because Mendel studied 7 traits at a time.
Learn more about Mendel' experiment, here; https://brainly.com/question/3056662
#SPJ2