Answer:
It has thorns on its stem
Explanation:
Deana applies the data in the table to calculate the rate of population increase or decrease of each country. Which assumption is necessary for Deana’s calculations to be accurate?
It should be noted that population is simply used for the determination of the economic activity of an area or country.
Your information is incomplete. Therefore, an overview of population will be given. Population simply means the inhabitants of a particular place or the number of organisms living in an area.
The increase or decrease in the rate of population is calculated by the formula:
= (New population - Old population) / Old population × 100
Learn more about population on:
https://brainly.com/question/13403673
ASAP
Give an example of psuedo-science and explain why it is not considered true science.
Answer:
Astrology
Explanation:
Astrology is considered a psuedo-science because there are not rock hard scientific facts. While it may have a lot of other evidence behind it, it is not a 'scientific' science.
Write any two adaptational characteristics of camel on the basis of habitat.
Proteins are synthesized based on genetic information carried by DNA. Explain In you’re own words how the structure of DNA is important in the
synthasis of different kinds of proteins, In your explanation, include a description of the two main processes involved in
protein synthesis.
Answer:
Explanation:The synthesis of proteins occurs in two sequential steps: Transcription and Translation. Transcription occurs in the cell nucleus and uses the base sequence of DNA to produce mRNA. The mRNA carries the message for making a specific protein out to the cytoplasm where translation occurs.
Match the materials below to the BEST option describing their place in the cycles of photosynthesis and cellular respiration.
Some options may be used more than once or not at all.
4. What is a function of the nucleus of an animal cell?
A. It is the place where energy is produced.
It stores the genetic information, the DNA (chromosomes).
C. It defends the cell from infections.
D. It captures sunlight to produce food.
5. Select a statement that best completes the phrase below. In a plant
Answer:
A. It is the place where energy is produced.
It stores the genetic information, the DNA (chromosomes).
Explanation:
28 The statements describe four different plants.
Which plant must be a monocotyledon?
A The flowers are wind-pollinated.
B The flowers each have five petals.
The leaves are large with a clear network of veins on them.
The leaves have parallel veins.
Answer:
The leaves have parallel veins
This part of a plant cell makes the process of photosynthesis possible.
Chloroplast
O Mitochondria
O Centrioles
The chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.
Photosynthesis refers to the metabolic reactions by which plant cells synthesize simple carbohydrates (glucose) by using the light energy from the sun and carbon dioxide.Photosynthetic reactions can be divided into light-dependent reactions and light-independent reactions.During photosynthesis, light-dependent reactions occur in the thylakoid membranes of chloroplasts.In conclusion, the chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.
Learn more about chloroplasts here:
https://brainly.com/question/2512051
What is the function of the structure labeled C in the diagram to the right? it is where water, dissolved substances, and urea are filtered out of the blood.
Answer:
B. It captures the substances filtered out of the blood.
Explanation:
Edge 2021
Answer: B
It captures the substances filtered out of the blood.
Explanation:edge 2022
Need help right now can’t figure it out
Answer:
[tex]\huge\boxed{Alkane.}[/tex]
Explanation:
The given compound is an alkane because all the bonds between carbon are single. Alkanes have all single bonds and are thus called saturated hydrocarbons.
[tex]\rule[225]{225}{2}[/tex]
Hope this helped!
~AH1807The desertification of an area from deforestation due to mining gold would be a(n) ___ cost of the gold.
indirect
direct
Answer: the answer would be indirect
Here is fs fs da last graph I need help so someone plz help me
My dad scolded me i don’t wanna live with him I hate him
Pandas eat bamboo for energy. What are pandas classified as
Answer:
A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.
Explanation:
A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.
Answer: consumers
Explanation: I took the test on edg
Granite is an intrusive igneous rock with large crystals because it cools slowly. Where was this rock most likely formed ?
A - in a river
B - deep inside a volcano
C- in a mountain range
D- on the surface of a volcano
Ik the answer is not c
Can someone help me figure this out plz and thank you
Answer: D
Explanation: Because rock cools on the surface of the volcano and I know because I learned about volcanoes and I went through the topic.
Granite is an intrusive igneous rock with large crystals because it cools slowly. this rock most likely formed on the surface of a volcano. thus option D is correct.
What is rock cycle ?
Rocks are naturally occurred on non-living earth which are made by collection of mineral grains held together in a firm, it can be tiny or big as well and can be easily identified with their texture.
The Rock cycle can be defined as a continuous process through which old rocks are transformed into new rock due to cool down of molten magma, when it solidifies become igneous rock.
In a rock cycle, when the break down of these igneous rocks occur small particles that are transported and deposited to form sedimentary rocks, When the igneous and sedimentary rocks heated up and under the pressure they change into metamorphic rocks.
The metamorphic rocks which are subjected under great heat and pressure melt down to form molten magma which again can cool down and solidify into igneous rocks
For more details regarding rock, visit
brainly.com/question/9243222
#SPJ2
An animal is grouped as an insect if it has:
eight legs
six legs
Or a backbone
Answer: six legs :)
PLEASE HELP WITH THIS ONE QUESTION
Answer:
Fourth option
Explanation:
ATP - Adenosine Triphosphate (3Ps), ADP - Adenosine Diphosphate (2Ps). ATP breaks down into ADP because it loses a Phosphate Anion in whatever process that the ATP is becoming ADP.
In the image provided, fourth image shows how ATP breaks down into ADP. Option D is the correct answer.
ATP (adenosine triphosphate) is a molecule that stores and provides energy for cellular processes. When ATP is used, it undergoes a process called hydrolysis, where a water molecule is used to break a high-energy phosphate bond in ATP. Option D is the correct answer.
During this hydrolysis process, one of the phosphate groups in ATP is cleaved off, resulting in the formation of ADP (adenosine diphosphate) and an inorganic phosphate (Pi). The energy stored in the phosphate bond is released, making it available for cellular functions. The breakdown of ATP into ADP allows the released energy to be utilized by cells for various activities, such as muscle contraction, active transport, and synthesis of molecules.
Learn more about Adenosine Triphosphate here:
https://brainly.com/question/897553
#SPJ2
Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.
Your skeleton enables you to move.
True
False
Answer:
True
Explanation:
Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.
Answer:
Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.
Explanation:
please mark my answer in brainlist
Individuals that are better suited to their environment are likely to have more offspring and pass their genetic material onto future generations. This theory is referred to as ____.
Question 1 options:
Use and Disuse
Endosymbiosis
Evolution
Natural Selection
Answer:
Natural selection
Answer:natural selection
Explanation:
I hate my biology teacher but he’s such a D.a.d.d.y
Answer: Dam
Explanation: Dammmmmmmmm
[answers included, 100% on assignment]
1. Compared to today’s corn plant, teosinte:
✔ (c) is shorter and has more branches.
2. About how many genes were involved in producing the dramatic differences between teosinte and modern corn?
✔ (b) 5
3. he gene for which of the following traits changed early in teosinte domestication and caused dramatic changes?
✔ (a) kernel covering
Answer:
C
B
A
Explanation:
Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
Answer:
CCGATAGGT
Explanation:
got this for my hw.
Answer:
So the central dogma of molecular biology describes the journey from DNA to protein product:
DNA --transcription--> mRNA --translation--> Protein
Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).
In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.
5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’
We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:
mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.
Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.
To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.
5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu
Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.
In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.
Explanation:
n
In which of the following ways can albert reduce the resources he consumes
Answer:
where is option man?
please,send option also
Which scenario describes an interaction between two of Earth’s spheres?
Water flows from a stream to a lake.
Gravity moves rocks to another location.
Lions use energy to catch other animals for food.
Bears dig big holes in the ground to protect their young.
Answer:
The scenario that describes an interaction between two of Earth's spheres is "bears dig big holes in the ground to protect their young".
Explanation:
The Earth spheres include the biosphere, the hydrosphere, the geosphere, and the atmosphere. In this context, there is an interaction between two spheres: the biosphere and the geosphere, when a bear digs holes in the ground because a living organism that is part of the biosphere is modifying the structure and shape of superficial soil, which is part of the geosphere.
Ba
Regarding cell walls, which of
these is the MOST accurate?
im
A. Cell walls and cell membranes are the very
same thing
B. Cell walls burst any time the cell takes in too
much water.
C. Cell walls keep a plant, bacteria or fungus cell
from bursting when too much water is absorbed
Answer:
C
Explanation:
cell wall
When water moves into a plant cell, the vacuole gets bigger, pushing the cell membrane against the cell wall. The force of this increases the turgor pressure within the cell making it firm or turgid . The pressure created by the cell wall stops too much water entering and prevents cell lysis.
pls check help /edtrphzjbi
Answer:
I don't get it but heres your answer
Explanation:
sharghvquvbOIQUugua
There you go!
How is it possible to find the
number of heterozygotes in a
sample population, given the
allele frequencies?
Explanation:
The frequency of heterozygous individuals. Answer: The frequency of heterozygous individuals is equal to 2pq. In this case, 2pq equals 0.32, which means that the frequency of individuals heterozygous for this gene is equal to 32% (i.e. 2 (0.8)(0.2) = 0.32
To find the number of heterozygotes in a sample population, we need to know the allele frequencies and the total number of individuals in the population. The formula used to calculate the expected number of heterozygotes in a population is based on the Hardy-Weinberg equilibrium principle.
The Hardy-Weinberg equation is given as:
p² + 2pq + q² = 1
Where:
p = frequency of one (dominant) allele
q = frequency of the other allele (recessive) allele
p² = expected frequency of homozygous dominant individuals
2pq = expected frequency of heterozygous individuals
q² = expected frequency of homozygous recessive individuals
To find the number of heterozygotes, we can multiply the expected frequency of heterozygotes (2pq) by the total population size. This will give us an estimate of the number of individuals in the population who are heterozygous for the specific gene of interest.
Learn more about Hardy-Weinberg equation in:
https://brainly.com/question/29776155
#SPJ2
According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?
Answer: Isaac
Explanation:
How can i earn money from this app?
Answer:
u dont earn money from brainly. the point is altruistic help
Explanation:
if u mean something else, provide context and ill leave a comment with the correct answer