20 PTS!

If an object is moving at a constant velocity, which must be true?

Its acceleration is zero.

Its acceleration in decreasing.

Its acceleration is increasing,

Its acceleration is a non-zero constant.​

Answers

Answer 1

[tex]\huge \bf༆ Answer ༄[/tex]

The Correct choice is ~ A

[tex] \textsf{its \: acceleration \: is \: zero}[/tex]

If an object moves at a constant velocity, then the change in velocity over the time is 0, Acceleration is defined as rate of change in velocity but since there is no change in velocity, the value of Acceleration is equal to Zero.


Related Questions

PLEASE ASP HELP THIS WILL GIVE 50 POINT AND BRAINLIEST!!!!!!
In introductory physics, a typical cavendish balance for measuring the gravitational constant G use metal masses 2.39kg and 16g whose center are separated by 6.81cm calculate the gravitation force between these forces, treating each as a point mass located at the center of the sphere.

gravitational constant =6.67259 × 10⁻¹¹N·m²/kg²

Answers

Answer:

Explanation:

F = GMm/d²

F = 6.67259 x 10⁻¹¹(2.39)(0.016) / 0.0681²

F = 5.5019685...x 10⁻¹⁰ N

round as appropriate, probably no more than 3 significant figures.

Value of G seems low, but well within the 3 significant figures of the other numerals. I typically see G = 6.674 x 10⁻¹¹

Which is better, forward bias or reverse bias, and why ?!

Answers

Answer:

reverse bias

Explanation:

bcz the potential barrier and impedes the flow of charge carriers. In contrast, a forward bias weakens the potential barrier, thus allowing current to flow more easily across the junction.

Energy can be changed from one form to another. Which terms can be used to describe these changes? Check all
that apply.
energy conversion
energy conservation
energy correlation
energy transformation
energy transference

Answers

Answer:

energy transformation

Answer: Energy Transformation & Energy Conversion.

esse is swinging Miguel in a circle at a tangential speed of 3.50 m/s. If the radius of the circle is
0.600 m and Miguel has a mass of 11.0 kg, what is the centripetal force on Miguel? Round to the nearest whole number.

Answers

Answer:

Explanation:

F = mv²/R

F = 11.0(3.50²)/0.600 = 225 N

That’s easy please tell me!

Answers

Uhh 3 seconds? i think

5. average A body sets off from rest with a constant acceleration of 8.0 m/s? What distance will it have covered after 3.0 s? 6.

Answers

Answer:

[tex]\boxed {\boxed {\sf 36 \ meters}}[/tex]

Explanation:

We are asked to find the distance a body covers. We know the initial velocity, acceleration, and time, so we will use the following kinematic equation.

[tex]d= v_i t+ \frac {1}{2} \ at^2[/tex]

The body starts at rest with an initial velocity of 0 meters per second. The acceleration is 8 meters per second squared. The time is 3.0 seconds.

[tex]v_i[/tex]= 0 m/s a= 8 m/s²t= 3 s

Substitute the values into the formula.

[tex]d= (0 \ m/s)(3 \ s) + \frac{1}{2} (8 \ m/s^2)(3 \ s)^2[/tex]

Multiply the first set of parentheses.

[tex]d= ( 0 \ m/s * 3 \ s) + \frac{1}{2} ( 8 \ m/s^2)(3 \ s)^2[/tex]

[tex]d=0 \ m + \frac{1}{2} ( 8 \ m/s^2)(3 \ s)^2[/tex]

Solve the exponent.

(3 s)²= 3 s* 3 s= 9 s²

[tex]d= 0 \ m + \frac{1}{2}( 8 \ m/s^2)(9 \ s^2)[/tex]

Multiply again.

[tex]d= 0 \ m + \frac{1}{2} ( 72 \ m)[/tex]

[tex]d= 36 \ m[/tex]

The body will cover a distance of 36 meters.

Avery is experimenting with a simple circuit. She measures the current in the circuit three different times with a different battery each time. First, she uses a 1.5-volt battery. Next, she uses a 3-volt battery. Last, she uses a 9-volt battery. The resistance stays the same during each test. How did the current change for each test? Explain.

Answers

Answer: the current increases with each 3 volt and 9 volt. The relationship between resistance and current in a circuit is that the greater the resistance the less the current and the greater the current the less the resistance is. yayayay I could answer this I big brain :)

A boy weighing 445 N swings on a 2-m long swing. If his horizontal speed at the lowest point is 3 m/s, what total force must the ropes holding the swing be able to withstand?

Answers

Explanation:

We need to calculate the centripetal force:

Fc = W + F

With Fc being the centripetal force, W the weight of the boy, F the centrifugal force (apparent).

We know that we can calculate the apparent centrifugal force thank to the formula:

F = (m·v²)/r = 204N

So we can write:

Fc = W + F = 445N + 204N = 649N

Assume each trial ( roll of cubes) represents 1000 years. Imagine that you found a rock sample was 25% Lokium and 75% DOL, how would the rock sample be given the half-life you figured out? Show your work

Answers

Assuming each trial represents 1000years, and rock samples were found, the rock sample will be given half-life of

The rock sample will be [tex]2000years[/tex] old

Isotope

We know that the parent Isotope remaining is given by the expression

[tex]\frac{1}{2}^n[/tex]

where,

n = number of half lives passed

lokium Isotope

From the question, the parent Isotope remaining is [tex]25\%[/tex] lokium

[tex]0.25 = \frac{1}{4} = \frac{1}{2^2} = \frac{1}{2}^2[/tex]

Therefore,

[tex]\frac{1}{2}^2[/tex] means 2 half lives have passed.

If from the question,

1 half life = 1000years

Rock age

Therefore,

The rock sample's age = [tex]2*1000 = 2000years[/tex]

For more information on rock samples such as lokium and DOL , visit

https://brainly.com/subject/chemistry

Pleas help with question 25

Answers

Answer:

the answer is a....,.......

A runner of mass 80 kg is moving at 8.0 m/s. Calculate her kinetic energy. ​

Answers

Answer:

2560J

Explanation:

By definition the kinetic energy can be calculated in the following way:

K = (mv²)/2 = 80kg·(8.0m/s)²/2 = 2560 J

6. The first vertebrates appeared during
a. Precambrian time
b. the Paleozoic Era
C. the Mesozoic Era
d. The Cenozoic Era

Answers

Answer:

b. the Paleozoic Era

Explanation:

The first vertebrates to appear are primitive fish in the Cambrian Period, but bony fishes with actual bony vertebratae didn't appear for another 100 million years. The Cambrian Period is the first of three periods in the Paleozoic Era. The Cambrian explosion was an event when practically all major animal phyla started appearing in the fossil record.

Oceanic crusts tend to be darker in color than continental crust. This is best explained by the fact that A) Oceanic crust is older than continental crust. B) Oceanic crust is denser than continental crust. C) Oceanic crust is thinner than continental crust. D) Oceanic crust is consist mostly of basalt while continental crust consist mainly of granite.

Answers

Answer:D

Explanation:USA test prep

Oceanic crusts tend to be darker in color than continental crust because

Oceanic crust consist mostly of basalt while continental crust consist mainly

of granite.

Oceanic crust are found under oceans while continental crust have most of

its parts above sea level. This explains why Oceanic crust is thinner than

continental crust due to the compression force from water.

Oceanic crust contains dark-colored rocks such as basalt while continental

crust contain light colored rocks such as granite which is why Oceanic

crusts tend to be darker in color than continental crust.

Read more on https://brainly.com/question/13907725

A teacher took two latex balloons and blew them up with helium gas to the same size. She took one and labeled it Balloon A and placed it in a -15o C freezer. The second one she labeled BALLOON B, and she took it outside and tied it to the railing in the sun on a 30o C day. After a half hour, she had the students measure the circumference of each balloon. Which TWO outcomes do you predict the students will find and why?

Answers

Answer:

n

Explanation:

TWO outcomes can be predicted the students will find:

The size of balloon A becomes smaller.The size of balloon B becomes larger.

What is the relation between temperature and volume of the gases?

When a constant mass of gas is cooled, its volume falls, and when the temperature is raised, its volume grows. The volume of the gas rises by 1/273 of its initial volume at 0 °C for every degree of temperature rise.

In layman's words, the volume of a fixed mass of gas is exactly proportional to temperature at constant pressure.

The teacher took two latex balloons and blew them up with helium gas to the same size. As she placed Balloon A in a -15° C freezer, its temperature decreases and that's why, the size of balloon A becomes smaller. Again she  placed Balloon B in the sun on 30° C day, its temperature increases and that's why, the size of balloon B becomes larger.

Learn more about temperature here:

https://brainly.com/question/11464844

#SPJ2

What are the advantages of vacuum diode ?​

Answers

Answer:

An electron tube from which all air has been removed. The vacuum ensures transparency inside the tube for electric fields and moving electrons. Most electron tubes are vacuum tubes; cathode-ray tubes, which include television picture tubes and other video display tubes, are the most widely used vacuum tubes

Explanation:

hope it help

The degree of coldness or hotness is different for different objects. Explain with an example

Answers

Answer:

Explanation:

The degree of hotness and coldness of air is known as temperature and is measured with a thermometer in degrees-Fahrenheit or degrees-Celsius. Mercury is the only one in the liquid state at room temperature. It is used in thermometers because it has a high coefficient of expansion. The flow of heat will be always from higher to lower temperature.

PLS MARK ME WITH BRAINLEST

1. An electrically charged atom ___________

Answers

Answer:

Is called an Ion

Explanation:

Answer:

An electrically charged atom is called an ion

2- What is the kinetic energy in (N.m) and Joules of a 4Kg bowling ball rolling down a

bowling lane at 10 m/s? compare this energy with that of a 250g baseball traveling 50

m/s. which object would hurt more if it hit you (i.e., which object has the greater kinetic

energy)?

Answers

Happy Holidays!

Recall the equation for kinetic energy:

[tex]\large\boxed{KE = \frac{1}{2}mv^2 (J)}}[/tex]

m = mass (Kg)

v = velocity (m/s)

KE = kinetic energy (Nm or J)

We can find the kinetic energy for both the bowling ball and baseball:

Bowling ball:

[tex]\large\boxed{KE = \frac{1}{2}(4)(10^2) = 200 J}[/tex]

Baseball:

[tex]\large\boxed{KE = \frac{1}{2}(.25)(50^2) = 312.5 J}[/tex]

Since 312.5 J > 200 J, the BASEBALL has the greater kinetic energy. Thus, it would exert a greater impact force than the bowling ball, so it would hurt more.

I need help with this answer I believe it's a democracy​

Answers

Answer:

a. democracy

Explanation:

beacouse the government control of their members

Below are three graphs. The shape of graph 3 shows that the current flowing through this component is __________ proportional to the potential difference across it. What one word completes the sentence?

Answers

The relationship between variables might be either directly porportional to each other or inversely proportional to each other. For instance, the current flowing is _directly_ proportional to the potential difference across it.

---------------------

Since I do not have the graph, I will propose two potential options and I will describe each of them.

I suggest you to choose the one that matches the shape of graph 3.

GraphsProbably your graph is composed of the X and Y axes, perpendicularly placed, in a way in which four quadrants are formed.

You might see that one of the axes represents the current (I), and the other one represents the potential difference (V).

And a straight line that represents the relationship between the current and the potential difference.

The direction of the straight line reflects the relationship between variables.

The change on each variable is proportional to the change on the other variable. Now we have to analyze how that change occurs. Option 1

The current flowing through this component is __DIRECTLY__ proportional to the potential difference across it.

If this is the case of your graph, you should see the straight line crossing from the left inferior quadrant to the right superior one.

The direction of the line suggests that one of the variables increases as the other one increases too. The current increases as the potential increases.

This is the case of the Ohm's law.

Option 2

The current flowing through this component is __INVERSELY__ proportional to the potential difference across it.

If this is the case of your graph, you should see the straight line crossing the right quadrant from the superior left corner to the inferior right one.

The direction of the line suggests that the variable represented in the Y ax decreases as the other one increases.

For instance, The current decreases as the potential increases. Or the potential decreases as the current increases.

In the attached files you will find graphs of both options.

-------------------------

You can learn more about the Ohm's law at  

https://brainly.com/question/17286882?referrer=searchResults

You can learn more about the relationship between variables at

https://brainly.com/question/16937826?referrer=searchResults

https://brainly.com/question/21627823?referrer=searchResults

Answer: The relationship between variables might be either directly proportional to each other or inversely proportional to each other. For instance, the current flowing is directly proportional to the potential difference across it.

Explanation:

Which law of motion uses the formula mass = force x acceleration?

Answers

Answer:

Newton's second law

Explanation:

a ball of mass 0.15 kg is attached to one end of a string 1.10 m long. the ball moves in a horizontal circle with a speed of 12 m/s. determine the magnitude of the tension in the string​

Answers

Answer:

[tex]19.64N[/tex]

Explanation:

Let's remember that if a mass describes a circle of radius [tex]l[/tex] with a constant speed of [tex]v[/tex], it has an angular velocity [tex]\omega=\frac vl[/tex]. in our case, our angular velocity will be of [tex]12/1.1= 10.91 rad/s[/tex].

Now that same mass will be subject of a centripetal acceleration [tex]a_c[/tex], caused of the tension of the string, equal to [tex]a_c=\omega^2l[/tex], which, in our situation, will be [tex](10.91)^2\times1.1=130.91 m/s^2[/tex]

We're almost done. We got mass, we got acceleration, the tension has to be their product: [tex]T= ma=130.91\times0.15=19.64N[/tex]

refers to a fear of being trapped in a crowded, public place.

Answers

Answer:

Agrophobia

Explanation:

an anxiety disorder in which someone feals anxious and scared in a public place

If 90J of energy are available for every 30C of charge, what is the potential difference?
Enter your answer as a number
V

Answers

Answer:

3 v

Explanation:

a bicycle with tires 68 cm in diameter travels 9.2 km. how many revolutions do the wheels make

Answers

Answer:

Explanation:

Circumference in meters is

C = πD = 0.68π

9200 m / 0.68π m = 4,306.545518...

4,306.5 revolutions

A bicycle with tires 68 cm in diameter travels 9.2 km. the number of revolutions made by the wheel would be 4309

What is Velocity?

The total displacement covered by any object per unit of time is known as velocity. It depends on the magnitude as well as the direction of the moving object.  It can also be represented by the infinitesimal rate of change of displacement with respect to time. The unit of velocity is meter/second.

The mathematical expression for velocity is given by

velocity= displacement  / time taken

As given in the problem a bicycle with tires 68 cm in diameter travels 9.2 km

Diameter = 68 cm

radius = diameter /2

          = 68/2

         = 34 cm

The distance covered by the tire in one cycle would be

distance in one revolution = 2π×Radius

                                            = 2×3.14× 34

                                            = 213.52 cm

                                            =2.13 m

The number of revolutions by wheel = total distance/distance in one revolution

number of revolutions = 9200/2.135

                                    =4309 revolutions

Thus, the number of revolutions made by the wheel would be 4309

Learn more about Velocity from here

brainly.com/question/18084516

#SPJ6

The part of the moon that is visible will appear to grow and shrink during the lunar cycle. This occurs in the direction of _____ to _____.

Answers

Answer:

left to right

Explanation:

give me brain pls

Answer:

of the moon to .......

PLEASE ANSWER QUICK GIVING BRAINLIEST TO THE ONE WHO ANSWERS

Describe what happens when iron and oxygen combine. Can the change be reversed?

Answers

Answer:

iron combines with oxygen to produce rust, which is the compound named iron oxide.

Explanation:

How large is the tension in a rope that is being used to accelerate a 100 kg box upward at 2m/s2?

Answers

m=100kgAcceleration=2m/s^2

[tex]\\ \sf\Rrightarrow T=F[/tex]

[tex]\\ \sf\Rrightarrow T=ma[/tex]

[tex]\\ \sf\Rrightarrow T=100(2)[/tex]

[tex]\\ \sf\Rrightarrow T=200N[/tex]

Destination is your Destination ​

Answers

Answer:

woah awesome so cool

Explanation:

Answer:

woah excellent!

A ball is kicked horizontally from a 60 meter tall cliff at 10 m/s. How far from

the base of the cliff does it land?

Answers

Hi there!

We can begin by deriving the equation for how long the ball takes to reach the bottom of the cliff.

[tex]\large\boxed{\Delta d = v_it+ \frac{1}{2}at^2}}[/tex]

There is NO initial vertical velocity, so:

[tex]\large\boxed{\Delta d= \frac{1}{2}at^2}}[/tex]

Rearrange to solve for time:

[tex]2\Delta d = at^2\\\\t = \sqrt{\frac{2\Delta d}{g}}[/tex]

Plug in the given height and acceleration due to gravity (g ≈ 9.8 m/s²)

[tex]t = \sqrt{\frac{2(60)}{(9.8)}} = 3.5 s[/tex]

Now, use the following for finding the HORIZONTAL distance using its horizontal velocity:

[tex]\large\boxed{d_x = vt}\\\\d_x = 10(3.5) = \karge\boxed{35 m}[/tex]

Other Questions
If you are the driver or owner of a vehicle which is in a crash that is your fault and you are not. Malik jogged 2 miles in 20 minutes.What was his rate in miles per hour?10 miles per hour6 miles per hour23 mile per hour110 mile per hour the smallest division value of electronic balance Astatine-218 has a half-life of 1.6 seconds. If you begin with a 1.7 g sample of astatine-218, how much of the sample remains after 3.2 seconds? explain different users of computer in briefly? Find the area of the cuboid. The valence electrons of a krypton (Kr) atom in the ground state are located in theA. first energy level (shell).B. second energy level (shell).C. third energy level (shell).D. fourth energy level (shell). Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides? Pleaseeee help meee with this!!!!!!!!!!!! Norton Company purchased a building on January 2 by signing a long-term $480,000 mortgage with monthly payments of $4,500. The mortgage carries an interest rate of 10 percent. The amount owed on the mortgage after the first payment will be A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest Imagine you own a company that makes YOUR FAVORITE PRODUCT. Read the excerpt from a text about online learning. "Virtual schools were growing quite quickly," said Christina Martin, a policy analyst at the Cascade Policy Institute, a free-market think tank based in Portland, Ore. . . . The big issue, she said, was fairness. Some students have access to virtual schools because they have a learning coach to stay home with them, while others dont. Also, Internet connections can be costly, and not every family has one. And families have to pay for their own printing. . . . "An adult must stay with a child during the day and make sure theyre doing their work. " This information would best support a claim about students need for personal coaches. Internet supervision. High-tech gadgets. Equal access to technology.