2.
Which of these expressions is equivalent to -2(x - 5)?
A.
-2x – 5
B.
- 2x + 5
C.
-2x + 10
-2x – 10
D.

Answers

Answer 1

Answer:

C.

Step-by-step explanation:

Evalute -2(x-5)

-2x+10

Answer 2

Answer:

-2x+10

Step-by-step explanation:

-2(x-5)

= -2x +10 { multiplying equation by -2}

Note:

(-)×(-) = (+)

(+) × (+) = (+)

(-) × (+) = (-)

(+) × (-) = (-)


Related Questions

help & not just comment for points thank youu

Answers

Answer:

For me it looks like downward and upward parabola.

The graph is periodical meaning that it repeats itself after some point. This is because the motion of the wheel makes the car move up and then come back down again. Each local min point is likely where the riders get on the ride, since its closest to the ground. Each local max point is the highest point on the graph indicating when the car is at the top of the wheel.

Let's say that the vertical distance from the lowest point to the highest point is 50 feet, just as an example. This would mean the amplitude is half that at 50/2 = 25 feet. The amplitude represents the vertical distance from the center line to either the highest or lowest point.

The period describes how long each cycle takes. For instance, if it takes 60 seconds for a specific car to go from the bottom position, loop around, and then come back to the bottom position, then the period is 60 seconds. The frequency is simply 1 over the period. Though the frequency may not be used as much.

So overall this curve is likely a sine or cosine curve (depending on the phase shift of course). Also there's a vertical shift as well. Because we don't have any numbers to work with, the actual sine or cosine function cannot be determined.

Does anybody know what 4/5 ( + 1) is in standard form?

Answers

Answer:

4/5 + 1 = 5/5

Step-by-step explanation:

This is because the bottom number is the denominator and the top number is the whole number. So, when you add a whole number to a fraction, the whole number goes to the numerator, not the denominator.

The mid segment of the triangle is 5x-1. Find the value of x.

Answers

Answer:

The value of x = 6

Step-by-step explanation:

The Midsegment of a triangle theorem states that the midsegment of a triangle is parallel to the third side of the triangle and it’s always equal to the one half or 1/2 of the length of the third side.

Now we can conclude that from the given triangle, the length of midsegment is 5x-1 which is parallel to the side of length 58, and will always equal to 1/2 of the length of the side of length 58.

Mathematically it means:

[tex]5x-1\:=\:\frac{58}{2}[/tex]

solving to find the length of x

[tex]5x-1=29[/tex]

Add 1 to both sides

[tex]5x-1+1=29+1[/tex]

[tex]5x=30[/tex]

Divide both sides by 5

[tex]\frac{5x}{5}=\frac{30}{5}[/tex]

[tex]x=6[/tex]

Therefore, the value of x = 6

1+8k=-6+8k how many solutions? marking brainlyest

Answers

Answer:

there is no solutions

Step-by-step explanation:

Answer:

The equation has no solution

Step-by-step explanation:

1 does not equal -6

3 out of 4 students in one school named Apple
Pie as their favorite Thanksgiving food. If the
school has 100 students, how many chose Apple
Pie?

Answers

Answer

the answer is 75

Step-by-step explanation:

100 divided by 3 = 75 so there is 75 students

75 is the answer I have the same question as you

Will mark Brainliest

what is the range of the function

Answers

The range of the function is [-6, 4], as those are the lowest and highest y values, respectively.

To which subset of the real number system does -24 belong?

Answers

Answer:

The real numbers have the following important subsets: rational numbers, irrational numbers, integers, whole numbers, and natural numbers. To represent a number on the number line graphically, we plot a point or its coordinate where it is approximately located on the number line.

10 = -3 + x

Question 4 options:

x = 13


x = 7


x = -30


x = -7

Answers

Step-by-step explanation:

10= -3+x

10+3=x

x=13 is ur ans

PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Step-by-step explanation:

9 is 39

please help!!! I don't understand how this works.


Please explain how you worked it out...

Thanks!!​

Answers

Answer:

Step-by-step explanation:

64,000 x 6.2% divided by groups of 1.45 a

please help me quickly

Answers

Answer:

B is (4,0) and D is (8,10)

Step-by-step explanation:  Read the x and y cordinates

Answer:

(8,10)

Step-by-step explanation:

coordinates are set up like (x,y)

8 is in the x

10 is in the y

plzzzzzz helpppppp plzzz

Answers

Answer:

D. 6

Step-by-step explanation:

Answer:

B, 6

I think! hope it helped

HELP DUE ASAP WILL GIVE BRAINLIEST AND 100 POINTS

Answers

Answer:

what

Step-by-step explanation:

Answer:

i can't see the photo?!

give the quadrant each set of coordinates lies in

1 , 5
-2 , 4
-3 , 2
4 , -4

Answers

1) Quadrant 1
2) Quadrant 2
3) Quadrant 2
4) Quadrant 4
quadrant 1
quadrant 2
quadrant 2
quadrant 4

HELP PLSS

What is the slope of the line that passes through the points (-2, -5) and (6, 7)?

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]slope = \frac{7 - ( - 5)}{6 - ( - 2)} \\ [/tex]

[tex]slope = \frac{7 + 5}{6 + 2} \\ [/tex]

[tex]slope = \frac{12}{8} \\ [/tex]

[tex]slope = \frac{4 \times 3}{4 \times 2} \\ [/tex]

[tex]slope = \frac{3}{2} \\ [/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Answer:

3/2

Step-by-step explanation:

use the slope formula to solve

y2-y1 is 7- (-5) = 12

x2-x1 is 6- (-2) = 8

the formula is y2 -y1 over x2-x1 so

12/8

simplify it to 3/2 (fraction answer)

convert it to decimal if needed: 1.5 (decimal answer)

please help! asap!!!

Answers

Answer:

2 and 6 i think

Step-by-step explanation:

You buy a hat for $12 and give the cashier a $20 bill. How much change do you receive?

An expression is ____

Answers

Answer:

$8.00 Even

Step-by-step explanation:

Stan borrows $5,500 at a rate of 12% interest per year. What is the amount due at the end of 5 years if the interest is compounded continuously? In your final answer, include your calculations.

Answers

Answer:

1.) Without compound interest, you would earn only $8800.00. This means that thanks to the power of compound interest you will earn an additional $1191.83 in interest at the end of the 5 year term.

2.) Using the compounded interest formula, you will earn $22883.01 after the 7 year term.

3.) Because of the negative interest, the compounded amount is only $695,929.30.

4.) Putting money in a saving account is saving money with a lower earning compared to investments. Investments have the higher potential of earning more than just having a basic savings account.

Step-by-step explanation:

If you don't have compound interest, you would earn only $8800.00. This means that thanks to the power of compound interest you will earn an additional $1191.83 in interest at the end of the 5 year plan.

x2 + 8x + 4 = 0
please help

Answers

Answer:

x= -3/4 or x= 0.75

Step-by-step explanation:

2(5x + 3) - 2(2x - 3)

Answers

Factor: 6(x + 2)

Simplify: 6x + 12

Answer:

[tex]\boxed {6x + 12}[/tex]

Step-by-step explanation:

Solve the following expression:

[tex]2(5x + 3) - 2(2x - 3)[/tex]

-Use Distributive Property:

[tex]2(5x + 3) - 2(2x - 3)[/tex]

[tex]10x + 6 - 4x + 6[/tex]

-Combine like terms:

[tex]10x + 6 - 4x + 6[/tex]

[tex]\boxed {6x + 12}[/tex] (final answer)

2) There are 500 calories in 5 servings of Sour
Patch Kids. How many calories per serving?
How many calories are there in 8 servings?

Answers

there are 100 calories per serving and there a 800 calories in 8 servings.

Jessica has 120 stamps in a collection she bought 16 more Jessica wants plays the stamps equally and six pages of the book how many stamps will be on each page of the book 20 stamps 25 stance 30 stamps or $.40 Stan's

Answers

Answer:

30 stamps each

Step-by-step explanation:

This is the correct question:

Jessica has 120 stamps in a collection she bought 60 more Jessica wants to place the stamps equally and 6 pages of a book how many stamps will be on each page of the book

Total stamps = 120 + 60

= 180

Jessica wants to place the stamps equally on 6 pages of a book

how many stamps will be on each page of the book?

Each page of the book = Total stamps / number of pages in the book

= 180 / 6

= 30

Each page of the book will have 30 stamps each

cordenadas cartesianas​

Answers

Answer:

what

Step-by-step explanation:

Un sistema de coordenadas cartesianas es un sistema de coordenadas que especifica cada punto de forma única en un plano mediante un conjunto de coordenadas numéricas, que son las distancias con signo al punto desde dos líneas orientadas perpendiculares fijas, medidas en la misma unidad de longitud.

7/9 divided by 3/4 WITH A MODEL;)

Answers

That doesn't work.... they won't work.

1,000 decimeters equal 1 what?

Answers

Answer:

It's 1 kilometer

Step-by-step explanation:

A mutual fund company offers its customers a variety of funds: a money-market fund, three different bond funds (short, intermediate, and long-term), two stock funds (moderate and high-risk), and a balanced fund. Among customers who own shares in just one fund, the percentages of customers in the different funds are as follows: Money-market 25% High-risk stock 10% Moderate-risk stock 15% Short bond 12% Intermediate bond 7% Long bond 8% Balanced 23% A customer who owns shares in just one fund is randomly selected. a) What is the probability that the selected individual owns shares in the balanced fund? For your answer, please report the answer in decimals. For example, 50% would be submitted as .5.

Answers

Part b and c are missing and they are;

b. What is the probability that the individual owns shares in a bond fund? c. What is the probability that the selected individual does not own shares in a stock fund?

Answer:

A) P(balanced fund) = 0.23

B) P(bond fund) = 0.27

C) P(no stock fund) = 0.75

Step-by-step explanation:

We are given the percentages of customers in the different funds as follows:

Money-market: 25%

High-risk stock: 10%

Moderate-risk stock: 15%

Short bond: 12%

Intermediate bond: 7%

Long bond: 8%

Balanced: 23%

A) From the percentages given, we can see that the balanced fund is 23%.

Thus,this represents the probability as addition of all the given percentages gives 100%

Thus, probability that the selected individual owns shares in the balanced fund is;

P(balanced fund) = 23% = 0.23

B) From the percentages given, bond funds given are;

Short bond: 12%

Intermediate bond: 7%

Long bond: 8%

Thus,

probability that the individual owns shares in a bond fund is;

P(bond fund) = 12% + 7% + 8%

P(bond fund) = 27% = 0.27

C) Probability that the selected individual doesn't own shares in a stock fund is;

P(no stock fund) = 1 - P(stuck fund)

P(stuck fund) = High-risk stock +

Moderate-risk stock = 10% + 15% = 25% = 0.25

Thus;

P(no stock fund) = 1 - 0.25 = 0.75

Peter is planting trees in his yard. He wants the ratio of pine trees to oak trees to be 3 to 2. Peter wants to plant a total of 45 trees. How many pine trees should he plant?

Answers

Answer:

Step-by-step explanation:

Let the ratio of pine tree to oak tree=3x:2x

Where no. Of pine tree =3x

No. Of oak tree=2x

Total no. Of tree = 3x+2x=45

5x=45

X=9

So no. Of pine tree=3x=3x9=27 tree is answer

HELP ME OUT PLEASE IM BAD AT MATH

Answers

Answer:

it is -⅕ if youre asking for the slope

Answer:

I don't know what your looking for but the dots are at -3,-1 and 2,-2

Step-by-step explanation:

find the slope
help with this please it’s due soon :)

Answers

undefined!! i hope this helps

what is the volume of a A prism with a base area of 34 m2 and a height of 6 m.

Answers

Answer:

34 * 6 = 204

Thank you and please rate me as brainliest as it will help me to level up

Other Questions
Which of the following benefits do member of Congress not receive?retirementsalaryimmunity from arrestallowance (6th grade math) yasiara has 3/4 of cake. she wants to divide it up into 1/12 size pieces. how many pieces will she have? ( can you show work please) Me gusta tocar ___________. can someone help meWhat is the missing numerator?blank over seven plus thirteen over fourteen equals one and three fourteenths (20 points) a11 b8 c5 d2 PLEASE HELP Ill give brainliest!!! What is the main idea in the woman in the snow? Someone pls help zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks What is the slope, m, and y-intercept for the line that is plotted on the grid? Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason