. A certain rectangular prism is
4 inches long, 2 inches wide, and
3 inches high. Sketch the figure
and find its volume.

Answers

Answer 1
Volume = w * h * l
w = 2, h = 3, l = 4
2 * 3 * 4 = 24
Solution: 24 in^3
. A Certain Rectangular Prism Is4 Inches Long, 2 Inches Wide, And3 Inches High. Sketch The Figureand

Related Questions

5/6 x 2 2/5 solve using distributive property to find the problem

Answers

Answer:

2

Step-by-step explanation:

Answer:

5/6 x 2 2/5 = 2

Step-by-step explanation:

https://www.fractioncalc.com/

This calculator link will help you with fraction equations

:))

A plane traveling 480 miles in 1 hour travels how far in 15 minutes

Answers

Answer:

120 Miles

Step-by-step explanation:

Emily and her twin sister Erica were each given $500 for their birthday. Emily deposits her money in an account that pays 4.75% interest compounded annually. Erica deposits her money in a 5% simple annual interest account. After 10 years how much more money will Emily have in her account?
A $22.41
B $45.26
C $250.00
D $295.26

Answers

Answer:

B $45.26

Step-by-step explanation:

After 10 years

Emily will have 500 * 1.045^10 = $795.26

Erica will have 500 + 10*0.05*500 = 500 * 1.5 = 750$

Emily will have $45.26 more.

Which is the function g(x) for a restricted domain?
O g(x) = 3x-4; 2-4
O g(x) = 3x + 4; x > 0
O g(x) = 3/x+4; x 24
O g(x) = 35-4;> 0

Answers

The answer choice which correctly describe s the function g (x) for a restricted domain as required to be determined in the task content is; g (x) = ³√(x + 4) , x ≥ -4.

Which function correctly represents the function g (x) for a restricted domain?

As evident in the task content, the function which correctly represents the function g (x) for a restricted domain is to be identified.

By observation of the function;

g (x) = ³√(x + 4) , x ≥ -4.

As evident in the task content; the lowest value of g(x) is; 0.

By checking; when x = -4; the corresponding value of g (x) is;

g (-4) = ³√(-4 + 4)

g (-4) = 0.

On this note, the required function is; g (x) = ³√(x + 4) , x ≥ -4.

Read more on functions and domain;

https://brainly.com/question/20253960

#SPJ1

Determine whether the given equation has one solution, no solution, or infinitely many solutions. 2 - 3(x+ 4) = 3(3 - x) cannot be determined one solution Ono solution infinitely many solutions. ​

Answers

Answer:

no solution

Step-by-step explanation:

The given equation is :

2 - 3(x+ 4) = 3(3 - x)

We need to solve the equation. It can be done as follows :

2-3x-12 = 9-3x

As -3x gets canceled from both sides. It means the given equation has no solution.

please answer asap! no scam links or scam comments or reported.

Answers

Answer:

(-10,0)

Step-by-step explanation:

y = 3/2 x + 15

To find the x intercept let y =0 and solve for x

0 = 3/2x +15

Subtract 15 from each side

-15 = 3/2x -15+15

-15 = 3/2x

Multiply each side by 2/3

2/3 *-15 = 2/3 * 3/2x

-10 =x

The x intercept is

(-10,0)

Answer: (-10,0)

Step-by-step explanation:

Help! Will Give Brainliest!!!!

Answers

Answer:

The answer is C or B i dont really know

Step-by-step explanation:

I believe it’s C based off what i have learned

The radius of a cylindrical water tank is 4 ft, and its height is 10 ft. What is the volume of the tank?

Answers

Answer:

502 cubic feet

Step-by-step explanation:

The Volume of the tank is 502 cubic feet.

5x≥25 help th bewbsanks

Answers

X is greater than or equal to 5




To get this answer, we simply divide by five on both sides to isolate x

34 in.
16 in.
22 in.
Lateral Surface Area =
in squared
Total Surface Area =
in squared
Volume =
in cubed

Answers

Answer:

Step-by-step explanation:

Lateral surface area of the triangular prism = Perimeter of the triangular base × Height

By applying Pythagoras theorem in ΔABC,

AC² = AB² + BC²

(34)² = (16)² + BC²

BC = [tex]\sqrt{1156-256}[/tex]

     = [tex]\sqrt{900}[/tex]

     = 30 in.

Perimeter of the triangular base = AB + BC + AC

                                                      = 16 + 30 + 34

                                                      = 80 in

Lateral surface area = 80 × 22

                                  = 1760 in²

Total Surface area = Lateral surface area + 2(Surface area of the triangular base)

Surface area of the triangular base = [tex]\frac{1}{2}(\text{Base})(\text{Height})[/tex]

                                                           = [tex]\frac{1}{2}(30)(16)[/tex]

                                                           = 240 in²

Total surface area = 1760 + 2(240)

                               = 1760 + 480

                               = 2240 in²

Volume = Area of the triangular base × Height

             = 240 × 20

             = 4800 in³

g(r) = (r + 14)? – 49
1) What are the zeros of the function?
Write the smaller r first, and the larger T second.

Answers

The zeros are
Larger
Smaller
2)The vertex is (-12.5,-2.25)
Step-by-step explanation:
The given function is:

This function is already in the factored form therefore it is easy to find the zeros,

Either or
The zeros are or
b) The expanded form of the given function is:

We obtain the vertex form by completing the square:

The vertex form is:

Therefore the vertex is (-12.5,-2.25)

Answer:

smaller r =-21

larger r =-7

 

The vertex of the parabola is at

(-14,-49)

Which numbers could be a solution to the inequality? -6 < 3x+ 9 <21

Answers

Step-by-step explanation:

-6-9<3x<21-9

-15<3x<12

1) -15<3x

-5<x

2) 3x<12

x<4

so the range of the solution is -5<x<4

28÷x=168
What is the value of "x"​

Answers

It is 1/6 or .16 I used Photomath

complete the table below to show the differences bettween algebraic expression and equation

Answers

Complete the table below to show the differences between algebraic

expression and equation.

Describe each to show their differences.

Give 3 examples of each.

Answer:

Explained below with examples

Step-by-step explanation:

1. Algebraic expression in mathematics are basically expressions that are formed from variables, integer constants, and also algebraic operations.

Examples include;

>> 2x² − xy

>> 3ab + 2b²

>> x² + y²

2. An algebraic equation is a phrase where the two sides of the equation which are the left and right hand sides are connected by the equal to sign (=).

Examples are;

>> 3y - y² = 2y² + 2

>> 3x - 4y = x + 2

>> 5a + 3b = 2b - 1

x2 + 16x – 2 = 11
1) Rewrite the equation by completing the square.
Your equation should look like (x + c)2 = d or (x - c)2 = d.
I
+
utan
pls help

Answers

Answer:

(x+8)^2=77    and   x=negative 8±√77

Step-by-step explanation:

After watching a video, I got it right on Khan

The equation with completing the squares is (x + 8)² = 77.

What is an equation?

An equation is a mathematical statement that is made up of two expressions connected by an equal sign.

Example:

2x + 4 = 9 is an equation.

We have,

x² + 16x - 2 = 11

We can make complete squares.

x² + 16x - 2 - 11 = 0

x² + 16x - 13 = 0

x² + 2 x 8 x (x) -8² + 8² - 13 = 0

(x² + 16x + 8²) - 64 - 13 = 0

(x + 8)² - 77 = 0

(x + 8)² = 77

Thus,

The equation is (x + 8)² = 77.

Learn more about equations here:

https://brainly.com/question/17194269

#SPJ2

Which graph shows a dilation?

Answers

Answer:

Step-by-step explanation:

Sorry but im struggling with this too :(

Austin’s bus arrives at 7:55am if he starts his chores at 7:30 am will he be done in time to meet his bus explain your reasoning answer key

Answers

Answer:

it depends on his chores, how many he has, and how he does them

Step-by-step explanation:

Answer:

Yes

Step-by-step explanation:

I had the same question his chores only last for 15 minutes so yes he would be done in time

30 POINTS!! PLEASE HELP

Mai created a scale model of a shoe store her company plans to build. The ratio of the model's dimensions to the dimensions of the actual shoe store to
be built is 1:20. If the volume of the model was 35 ft, what is the volume of the actual shoe store that Mai's company plans to build?

Answers

Answer:

it's 700 so last one

Step-by-step explanation:

since it's 1 to 20 you multiply 35×20 and you get 700

If the logarithm of 5832 is 6, what is the base?
[tex] logx(5832) = 6[/tex]

Answers

Answer:

The base is 4.2426.

Step-by-step explanation:

Logarithm definition:

Suppose we have that:

[tex]\log_{a}{b} = c[/tex]

It means that;

[tex]b = a^c[/tex]

In this question:

[tex]\log_{x}{(5832)} = 6[/tex]

It means that:

[tex]x^6 = 5832[/tex]

[tex]x = \sqrt[6]{5832}[/tex]

[tex]x = (5832)^{\frac{1}{6}}[/tex]

[tex]x = 4.2626[/tex]

The base is 4.2426.

There are 17 girls and 23 boys in P.E class.Of these students,10 girls and 14 boys will try out for basketball.What percentage of the stidents will try out for basketball?​

Answers

Answer:

[tex]60%[/tex]%

Step-by-step explanation:

[tex]17+23=40[/tex][tex], 40[/tex] in total.

[tex]10+14=24[/tex], 24 students trying out.

24 of 40 as a percent[tex]=60[/tex]

Answer:

60%

Step-by-step explanation:

According to formula if finding percent, given number(10+14)divide by total number(17+23) multiply 100% which is 24/40*100= 60%

A book costs $1.49 and is sold in a retail store for $8.99. What is the percentage in mark up? *​

Answers

Answer:

603.35%

Step-by-step explanation:

Given that a book costs $ 1.49 and is sold in a retail store for $ 8.99, to determine what is the percentage in mark up, the following calculation must be performed:

1.49 = 100

8.99 = X

8.99 x 100 / 1.49 = X

899 / 1.49 = X

603.35 = X

Thus, the mark up percentage of the book is 603.35%, which implies an increase of more than 6 times its initial value.

Use the Trig Ratios to find the Missing Side Length

Answers

Answer:

[tex] \tan(55) = \frac{x}{8} \\ x = \tan(55) \times 8[/tex]

Translate the phrase into an algebraic expression. The difference of c and 6​

Answers

Answer:

c - 6

Step-by-step explanation:

differnce is subtraction

so subtract.

Do think it is A, B, C, D?

Answers

Answer:

D

Step-by-step explanation:

the 80*10=800

8 in 183= 80

8 in 4879 = 800

can i get help on this?

Answers

The third and last option. To solve the equation we take the reciprocal of 3/4 because you cannot divide fractions so it would be 15• 4/3, but flip this it could also be 15 divided by 3/4 you would just need to further simply the expression

what is the measure of m?
6
24
m
n​

Answers

Answer:

m=√180

Step-by-step explanation:

n² = 6×24

n² = 144

m² = n² + 6²

m² = 144 + 36

m² = 180

m =√180

What is the answer for (a^2+12c)÷7b-1

Answers

what are we solving for the value of a b and c or like how do u want this solved ?

A small bar of gold measures 20 mm by 250 mm by 2 mm. One cubic millimeter of gold weighs about
0.0005 ounces. Find the volume in cubic millimeters and the welght in ounces of this small bar of gold.
cubic millimeters and the weight of the bar is
The volume of the bar is
ounce(s).

Answers

Answer: 5 ounces

Step-by-step explanation:

volume is 20*250*2=10000 cubic mm

10,000*0.0005=5

7 1/2 divided by 3/4

Answers

Answer:

2 2/3

Step-by-step explanation:

Answer:

10

Step-by-step explanation:

First convert to mixed fractions 7 1/2-> 15/2

Then multiply by the reciprocal---> 15/2 x 4/3

The answer is 60/6

Then simplify---> 10/1 or 10

Which of the following could be the areas of the three squares below?

Answers

Answer:

A. 12 ft², 16 ft², and 20 ft²

Step-by-step explanation:

Other Questions
how do child laborers compare to child slaves from chocotate from children Ms. Morrison is purchasing a house and needs to finance a $150,000 mortgage fromthe bank with an annual percentage rate (APR) of 3.8%. She is financing it over 30years and making monthly payments. What is the monthly payment? Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help The area of a rectangle is 46 square inches. If the length is 4 times the width, thon findthe dimensions of the rectangle. Round off your answers to the nearest hundredth Nicole had 8 correct answers on her math test. There were 20 total questions. Enter the percent of the correct answers Nicole had. What is the slope of the line below?The image is a graph of an x-axis and a y-axis. A line is drawn which passes through the points (2,3) and (-2,-7). A. 5 B. 0.2 or 15 C. 2.5 or 52 D. 0.4 or 25 which inequality is true? lol please do it correctly, brainliest if right please dont post links no bots A city has a population of 340, 000 people. Suppose that each year the population grows by 3.75%. What will the population be after 10 years ? Use the calculator provided and round your answer to the nearest whole number. Complete the proof.Given: ABBP=CBBMProve: CBA~PBM Below shows a process that occurs in cells. The type of building blocks represented by the letters A, B, and C in this process are:A: NucleotidesB: CodonsC: Amino AcidsD: Nitrogen bases Why do you think superstitions and conspiracies are so powerful? Explain. A kicked soccer balleventually comesto rest. Whatforce causesthis?ce find the square rootV 196 please help me with this question