A plant costs p dollars and a bush costs b dollars. Ana buys 2 plants and 4 bushes for $42. Paola buys 7 plants and 9 bushes for $107. Write down a pair of simultaneous equations and solve them to find out the value of p and the value of b.

Answers

Answer 1

Answer:

p = 5 and b = 8

Step-by-step explanation:

First, create a system of equations:

2p + 4b = 42

7p + 9b = 107

Solve by elimination by multiplying the top equation by -7 and the bottom equation by 2:

-14p - 28b = -294

14p + 18b = 214

Add these together, and solve for b:

-10b = -80

b = 8

Plug in 8 as b into one of the equations, and solve for p:

2p + 4b = 42

2p + 4(8) = 42

2p + 32 = 42

2p = 10

p = 5

So, p = 5 and b = 8

Answer 2

Answer:

p = 5 and b =8

Step-by-step explanation:

2p + 4b = 42

2p = 42 - 4b

p = 21 - 2b

7p + 9b = 107

7 (21 - 2b) + 9b = 107

147 - 14b + 9b = 107

147 - 5b = 107

-5b = -40

b = 8

2p + 4 * 8 = 42

2p + 32 = 42

2p = 10

p = 5


Related Questions

easy question but need answer quick!!

Answers

Answer:

Step-by-step explanation:

Step 1:  Find slope of Linear function A

[tex]slope = \frac{y_2 - y_1}{x_2-x_1} = \frac{-5--1}{-4--2} = \frac{-5 +1}{-4+2} = \frac{-4}{-2} = 2[/tex]

Step 2 : Find slope of B

Since they are perpendicular to each other, product of their slope = -1

That is,

   [tex]m_A \times m_B = - 1\\2 \times m_B = -1\\\\slope, m_B = \frac{-1}{2}[/tex]

Given the function passes through (4, -6)

Equation of the linear function :

                                         [tex]x_3 = 4 \ , \ y_3 = -6\\\\(y - y_3) = m_B (x - x_3)\\\\(y - -6) = -\frac{1}{2} (x - 4)\\\\y + 6 = -\frac{1}{2}x + 2\\\\y = -\frac{1}{2}x + 2 - 6 \\\\y = -\frac{1}{2}x -4[/tex]

Part B

Linear Function is parallel to B

Therefore the slope of B and slope of C are the same. And the equation will be of the form :

                   [tex]y = -\frac{1}{2} x + C[/tex]

!!!!!!!!!PLEASE HELP!!!!!!!!

Answers

Answer:  D

Step-by-step explanation:

We're given a point (a,b) that happens to be on the unit circle, a²+b²=1, so a is the cosine of the angle θ and b is its sine.

Answer:

option 4

Step-by-step explanation:

Determine the domain of the following graph:

Answers

Answer:

-10<x<6

Step-by-step explanation:

Find where x starts and where x ends

What is the length of /AB?

Answers

Answer:

[tex]\sqrt{53}[/tex]

Step-by-step explanation:

|7|

What does this mean?

Answers

Absolute value of 7. Any real numbers in the absolute sign would equal to the positive value.

Definition

[tex] \large \boxed{ |x| = \begin{cases} x \: \: \: \: (x \geqslant 0) \\ - x \: \: \: \: (x < 0) \end{cases}}[/tex]

If we substitute x = 7 in. Answer by using the definition of absolute value. Note that we only substitute x = 7 in x and not -x since 7 is greater than 0 and not less than 0.

[tex] \large{ |7| = 7 \: \: \: \: (x \geqslant 0)}[/tex]

You may also be wondering what will happen if we substitute x = any negative numbers.

[tex] \large{ | - 7| = - ( - 7) \: \: \: \: (x < 0)} \\ \large \boxed{ | - 7| = 7}[/tex]

Because -7 is less than 0. We substitute in -x and not x. This is the definition of absolute value. But to understand it easily, any numbers in absolute value have to equal to their positive value.

Conclusion

|7| means the absolute value of 7.|7| is 7.|x| is x when x ≥ 0 but -x when x < 0

Let me know if you have any doubts regarding the absolute value through comment!

A researcher wanted to know if there was a difference in fall and spring semester tuition at universities across the U.S. His study took a random sample of 200 universities, had a p-value of 0.013 and found that the tuition had increased by an average of $0.35 between fall and spring semester. What can be said about the results of this study

Answers

Answer:

The given parameters of the study are;

The number of people in the sample, n = 200

The p-value = 0.013

The average increase between fall and spring semester = $0.35

Therefore, we have;

Given that the p-value is less than 0.05, we reject the null hypothesis, and that there is significant statistical evidence to suggest that there is a difference between the fall and spring semester tuition at universities across the U.S.

Step-by-step explanation:

The result of the test hypothesis is incorrect or should be rejected.

What is P-value?

Researchers frequently use P-values to determine if a trend they've seen is statistically significant. The p-value of a statistical test is small enough to reject the null hypothesis of the test, which is referred to as statistical significance.

What is the significance of the P-value?

The likelihood that the null hypothesis is true is P > 0.05. The likelihood that the alternative hypothesis is correct is (1-P) the P-value. The test hypothesis is incorrect or should be rejected if the test result is statistically significant (P≤0.05). There was no effect if the P-value was bigger than 0.05.

We reject the null hypothesis since the p-value is less than 0.05, and there is strong statistical evidence to imply that there is a difference between autumn and spring semester tuition at institutions across the United States.

Hence, the result of the test hypothesis is incorrect or should be rejected.

Learn more about P-Value:

https://brainly.com/question/15407907

PLEASE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP

Answers

Answer:

63/10,  6.396,  6.99,  7 4/11

Step-by-step explanation:

Convert all to fraction or decimal

What is the multiplicative rate of change of the function?
2/3
3/4
4/3
3/2

Answers

Answer: 3/4

Step-by-step explanation:

Did the test

The required multiplicative rate in the given function is 3 / 4. Option B is correct.

What is an exponential function?

The function which is in format f(x) =a^x  where a is constant and x is variable,  the domain of this exponential function lies   (-∞, ∞).

Here,
From the table of the exponential functions,
The multiplicative factor is given as,
K = y₂/y₁
K =  [9 / 8] / [3/2]
K = 3 / 4

Thus, the required multiplicative rate in the given function is 3 / 4. Option B is correct.

learn more about exponential function here:

brainly.com/question/15352175

#SPJ2

F(x)= x^2 . What is g(x)?

Answers

the answer is B, g(x)= (9x)^2

EVALUATE 5/9 -1/4.............

Answers

Answer:

11/36

Step-by-step explanation:

Answer:

0.30555555555

Step-by-step explanation:

Given right triangle ABC, which of the following statements must be true
Check all that apply.

A. sin A = Cos(90° - A)
B. cosA = sin C
C. ZA and ZC are supplementary
D. sin A = Cos(90°-C)

Answers

A + B are correct

via a p e x

The correct statements are A and B

What is a right-angled triangle?

'A triangle in which one of the interior angles is 90° is called a right-angled triangle. The longest side of the right triangle, which is also the side opposite the right angle, is the hypotenuse and the two arms of the right angle are the height and the base.'

According to the given problem,

cos(A−B) = cosAcosB + sinAsinB .

Let A=90∘, B = a

Therefore.

cos(90∘−a) = cos90∘cosa + sin90∘sina.

Here, we have,

cos90∘ = 0, sin90∘ = 1.

cos(90∘−a) = sina

Now, we know,

sin∅ = [tex]\frac{Perpendicular}{Hypotenuse}[/tex]

cos∅ = [tex]\frac{Base}{Hypotenuse}[/tex]

For ∠BAC,

cosA = [tex]\frac{AB}{AC}[/tex]

For ∠ACB,

sinC =  [tex]\frac{AB}{AC}[/tex]

Hence, we can conclude, A and B are the true statements for the given right-angled triangle.

Learn more about right-angled triangle here:

https://brainly.com/question/13263113

#SPJ2

Im so confused so PLS HHELP !!!!!! ;-;

Answers

Answer:

Step-by-step explanation:

let -2/3 be the rational number and 9 be the positive real number

according to the given of indices this tis can be written as

[tex]9^{-2/3}[/tex]

[tex](3)^{2*-2/3}[/tex]

[tex]3^{-4/3}[/tex]

1/3^4/3

Please helpppp i have a test tomorrow the problem is in the picture below

Answers

Answer:

yes

Step-by-step explanation:

Can U pls Help Me pls​

Answers

Answer:

angle x= 60

so it is in the ratio 1:2:√3

√3x=3

ie.x=√3/3

adjacent side=x=√3/4

Step-by-step explanation:

everything can be found in the picture

18/30
G
35 m
Find the value of x:
H
18 m
30 m

Answers

Answer:

21 is the answer

Step-by-step explanation:

from the figure it can be seen that

angle G = angle J

angle H = angle K and

angle I = angle L

thus triangle GHI is similar to triangle JKL and in 2 similar triangles the ratio of their corresponding sides is same. that means

[tex] \frac{hi}{kl} = \frac{gi}{jl} \\ \frac{18}{30} = \frac{x}{35} \\ x = \frac{18}{30} \times 35 \\ x = \frac{3}{5} \times 35 \\ x = 3 \times 7 \\ x = 21[/tex]

Brainliest goes to whoever answers correctly and explains also if you want extra points answer my other questions

Answers

Answer:

1) y= 2x

for every 5 x-steps to the right the graph goes up by ten. 10/5 is simplified to 2/1 or just 2

it starts at 0/0, so no need to add and absolute value

2) x: number of days

y: number of vidits (roughly2 per day, but you don't need to write this in the box)

3) 35 days. it's just y=70

and we could write this as

70 = 2*x | devide by 2 on both sides to get x

35 = x

4. 12 ½ % of a sum of money is $40. What is the sum of money?

Answers

Answer:

$320

Step-by-step explanation:

12.5 % is 40

12.5% is 8% of 100%

so do 40 x 8 = 320

PLEASE HELP! What is the value of a?

A 12
B. 15
C. 17:25
D. 21.25

Answers

i think b. not sure sorry if im wrong

Hhhheeeelllllpppppppp

Answers

Answer:

35square meters

Step-by-step explanation:

5×7=35

Please helpppppp 7th grade mathhh

Answers

Answer:

10 quarts

thank you

i think

Answer: 20 quarts

Step by step explanation: Solve for x
2 gallons/ 8 quarts = 5 gallons/ x quarts
2x=40
x=20

Find the range of the data.
The ages of kids playing at a park.
4, 1, 3, 9, 6, 3, 2, 4
Range: [?]

Answers

Answer:

8

Step-by-step explanation:

Range is found by taking the largest number and subtracting the smallest number

The largest number is 9

The smallest number is 1

9-1 =8

The range is 8

Answer:

8

Step-by-step explanation:

Range = highest value - lowest value

Range = 9 - 1

Range = 8

Here are some cards with angles written on them.
45°
165°

90°
102°
31°
53°
Moira picks one of the cards at random.
What is the probability that the angle on the card is greater than 100°?

Answers

the answer is 165 I think because I didn't understand the question

Answer= (2/7) or about 0.29

Explanation: There are only two numbers that are greater than 100 (102,165). Divide the number of cards that are greater than 100° by the amount of cards that are given.

(2/7) = about 0.29

48 ÷ (7 x 5 - 3 x 9) whoever gets the answer right, gets brainliest and 47 points. please help fast!

Answers

48 ÷ (7 x 5 - 3 x 9)

= 48 ÷ (35 - 27)

= 48 ÷ 8

= 6

Step-by-step explanation:

only half of your points for each answer ;)

Answer: 6

Step-by-step explanation:

Because of PEMDAS, you do 7x5 which is 35 than 3x9 which is 27. Then you subtract those and get 8. After you finish what's in the parenthesis, you divide 48 by 8 which is 6.

Jessie made 312 energy bars. She puts 24 bars in each bag. She plans to sell the bags for $6 each. How much will she earn if she sells all of the bags? Will give brainliest.

Answers

Answer:

she will make 78 dollars

Step-by-step explanation:

312 divided by 24 is `13

13 times 6 is 78

What does 2x+4y=12 solve for?

Answers

2x+4y=12
divide by 4
0.5x+y=3
format into y=mx+b form
Answer: y=-0.5x+3

Answer:

Hi, there for x it will be x=−2y+6

But if your solving for y it will be [tex]y=-\frac{1}{2}x+3[/tex]

Hope this Helps :)

Step-by-step explanation:

Let's solve for x.

2x+4y=12

Step 1: Add -4y to both sides.

2x+4y+−4y=12+−4y

2x=−4y+12

Step 2: Divide both sides by 2.

[tex]\frac{2x}{2}=\frac{-4y+12}{2}[/tex]

x=−2y+6

2.

Let's solve for y.

2x+4y=12

Step 1: Add -2x to both sides.

2x+4y+−2x=12+−2x

4y=−2x+12

Step 2: Divide both sides by 4

[tex]\frac{4y}{4} =\frac{-2x+12}{4}[/tex]

[tex]y=-\frac{1}{2} x+3[/tex]

help plssss! i’m rly struggling in geometry

Answers

Answer:

i don't know

Step-by-step explanation:

fffgg

Helppppppppp meeeeee

Answers

Answer:

y=-1

Step-by-step explanation:

y=-1 just shows the y value which means its just a horizontal line which is parallel to the x axis.

how many groups of 15 minutes are there in 1 3/4 hours​

Answers

Answer:

7 groups

Step-by-step explanation:

1 hour = 60 minutes

3/4 of an hour = 3/4(60) = 45 minutes

therefore, 1 3/4 hours is 105 minutes

105 divided by 15 is 7

Find the volume of a right circular cone that has a height of 20 ft and a base with a
radius of 9.1 ft. Round your answer to the nearest tenth of a cubic foot.

Answers

Your answer will be 1733.489333ft³
When rounding it will be
1733.1ft³
My rounding might be wrong
Hope it helps : )

will give brainliest to correct answer​

Answers

Answer:

A = 5

B = -13

C = 7

Step-by-step explanation:

The general formula of quadratic equation is ax^2+bx+c.

Other Questions
Can yall help me?! :) An unstretched ideal spring hangs vertically from a fixed support. A 0.4 kg object is then attached to the lower end of the spring. The object is pulled down to a distance of 0.35 m below the unstretched position and released from rest at time t= 0. A graph of the subsequent vertical position y of the lower end of the spring as a function of t is given above, where y= 0 when the spring was initially unstretched. At which time is the upward velocity of the object the greatest? Out of the people who have already taken their seats at a seminar, 2 people have black hair while 2 people do not. Considering this data, how many of the next 16 people to take their seats should you expect to be black-haired? Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts Whoever answers these 2 right gets brainliest and 25 points! please help me :(Any Maths Moderator:( please help me; I am in great trouble I need help with another too! :( I will mark brainliest! You will get 30 piontsthe picture is right there too! The question is also in the picture too!I hope you could see it clrealy! Find the value of x. 0.45 written as a common fraction, in its simplest form, is Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer