Abby takes a ride-sharing service to ride from her home to the mall. The ride-sharing service charges $1.75 per mile plus a one-time charge of $5.00. Which equation can be used to find y, the total cost of the ride, given x represents the number of miles of the ride

Answers

Answer 1

Answer:

y=1.75x + 5.00

Step-by-step explanation:


Related Questions

CAN SOMEONE HELP THIS IS DUE

Hicham El Guerrouj of Morocco set a world record by running 1 mile in 3 minutes, 43.13 seconds on July 7, 1999. What was his time in miles per hour?

Answers

Answer:

His time in mph is 16.1 mph

Which scenario below represents 85%?

Answers

Show us the scenario

Find the value(s) of A so that XYZW is an isosceles trapezoid. All answers should be fully simplified.

Answers

Answer:

a = 4√5

Step-by-step explanation:

Given

Trapezoid XYWZ

As given, sides XW and YZ are parallel and XY = WZ

Since it is isosceles, angles X and W are of same size

Therefore:

a² + 15 = 2a² - 652a² - a² = 15 + 65a² = 80a = √80a = 4√5

I need help because I was debating if it’s is 5 or 6

Answers

Answer:

it should be 5.5

Step-by-step explanation:

cross multiply and solve as an equation

This is really confusing i need help if you get this right i will give you brainliest

Answers

Okie B or D

Maybe C

OK ok ok ok ok ignore that it's probably B? orC

okie nevermind there's lots of bullies and no one even know's I'm autistic people, okie baiiiii

Answer: I don't think the answer is B. -3/5+(-2/8)-4=-5 because B. -3/5+(-2/8)-4 A. (-40)+(-30)+28=-42, C. 130+70+(-37)=163, D. 40+(-58)+160=142. I think A. (-40)+(-30)+28=-42

how do you find the value of √a⁴ ??
(ill give brainliest)

Answers

Answer:

[tex]a^{2}[/tex]

Step-by-step explanation:

√a^4 is the same as:

√a × √a × √a × √a

group them as 2 pairs of

(√a × √a) × (√a × √a)

which makes

a × a

which is the same as [tex]a^{2}[/tex]

2³ =
what does it equal?

Answers

Answer:

8

Step-by-step explanation:

2 x 2 = 4

4 x 2 = 8

Answer:

8

Step-by-step explanation:

2^3 is the same as 2x2x2 (x is times)

what is the y-intercept of this table? i dont understand it please help thank you.

Answers

Answer:

-0.4

Step-by-step explanation:

you just take 2 of them to find it

In the equation 0.5x-8=1.5 the decimal coefficient is

Answers

Answer:-9.5

Step-by-step explanation:

Answer:

0.5

Step-by-step explanation:

The coefficient is the number that multiply the variable, in this case x.

Trisha uses 3 cups of sugar for every 4 cups of flour to make a batch of cookies. Which equation could be used to solve x, the number of cups of flour needed for 9 cups of sugar.

Answers

Answer: The number of cups of flour needed for 9 cups of sugar = 12.

Step-by-step explanation:

Equation of direct proportion between two quantities x and y :

[tex]\dfrac{x_1}{y_1}=\dfrac{x_2}{y_2}[/tex]

Let x=  the number of cups of flour needed for 9 cups of sugar.

Put [tex]x_1=4,\ y_1=3,\ y_2=9, x_2=x[/tex]

[tex]\dfrac{4}{3}=\dfrac{x}{9}\\\\\Rightarrow\ x=\dfrac{9\times4}{3}\\\\\Rightarrow\ x=12[/tex]

Hence, the number of cups of flour needed for 9 cups of sugar = 12.

Select all the lines in the proof of △ABC≅△CDA that have the correct justification. AB || CD and BC || AD, ASA Triangle Congruence Theorem ∠BAC≅∠DCA, Alternate Interior Angles Theorem △ABC≅△CDA, SAS Triangle Congruence Theorem ∠ACB≅∠CAD, Alternate Interior Angles Theorem AC≅AC, Reflexive Property of Congruence

Answers

Answer:

AB and MN

∠B and ∠N  

CB and LN

Step-by-step explanation:

edg

Martha compra 2 kilos de tomate y 1 kilo de cebolla pagando S/ 8,40. Si la siguiente semana compra 1 kilo de tomate y 2 kilos de cebolla pagando S/ 7,80, ¿a cuánto está el kilo de cebolla?

Answers

Responder:

2,40

Explicación paso a paso:

Dado que:

Dejar :

Tomate = t

Cebolla = n

(2 kilo de t) + (1 kilo de n) = 8.40

(1 kilo de t) + (2 kilo de n) = 7.80

2t + n = 8,40 - - (1)

t + 2n = 7,80 - - (2)

De (2);

t = 7,80 - 2n

Ponga t = 7.80 - 2n en (1)

2 (7,80 - 2n) + n = 8,40

15,6 - 4n + n = 8,40

15,6 - 3n = 8,40

-3n = 8,40 - 15,6

-3n = - 7,2

n = 2,4

t = 7,80 - 2 (2,40)

t = 7,80 - 4,80

t = 3

Por lo tanto, el costo de 1 kilo de cebolla es 2,40

Fraction 3•5 • fraction 4•9 =

Answers

Answer:

Step-by-step explanation:

3.5×4.9

=35/10×49/10

=1715/100

Or 17.15 answer

Answer:

Step-by-step explanation:

3/5 times 4/9. multiply straight across. 3 times 4 is 12. 5 times 9 is 45. your answer is 12/45. but this answer can be simplified if we take out a 3 for each one. so you have 4/15

In a full set of permanent teeth, 1/4 of the teeth are incisors, 1/4 are premolars, and 3/8 are molars. What fraction of all the teeth are incisors, premolars, and molars

Answers

Answer:

7/8

Step-by-step explanation:

In a full set of permanent teeth, 1/4 of the teeth are incisors, 1/4 are premolars, and 3/8 are molars. What fraction of all the teeth are incisors, premolars, and molars?

To solve the above, we add all the fractions together.

= Incisors + Premolars + Molars

= 3/8 + 1/4 + 1/4

Least Common Denominator = 8

= (3 × 1 + 2× 1 + 2 × 1)/8

= 3 + 2 + 2/8

= 7/8

Hence, the fraction of all the teeth are incisors, premolars, and molars is 7/8

I need some help and fast
Solve this plz

Answers

Answer:

It could be or 70 or 78

Step-by-step explanation:

Answer:

there the same they are both 84

Step-by-step explanation:

John is twice as old as Mary. The sum of their ages is 21. How old is Mary?
Let J = John's age and M = Mary's age. Select the system equations that represents the problem.
J - 2M = 0
J = M + 2
M - 2J = 0
J + M = 21

Answers

Answer:

Mary is 7

Step-by-step explanation:

If their ages combined equals 21 and john is twice Mary’s age then johns age takes up 2/3 of 21. that would b 14. 14 is 2 x 7. and Mary is 7. 14+7=21. Mary is 7 years old

Correct answers are:

J + M = 21

J - 2M = 0

pls help−4(3/2x−1/2)=−15

Answers

Answer:

17/6

Step-by-step explanation:

what you do first is open up the brackets..

so

-4 x 3/2x and -4 x -1/2

you then multiply these

-12/2x and 4/2

-6x and 2

(-6x+2) = -15

solve for x

-6x=-15 -2

-6x=-17

x=17/6

crossing out the negatives !

(picture)
for each number on the left,place a check mark under the numbers it is divisible by.​

Answers

45- 3, 5, 9

369- 3, 9

7870- 2, 5, 10

1976- 2, 4,

6003- 3, 9

136- 2, 3, 4

1674- 2, 3, 6, 9

35496- 2, 3, 4, 6, 9

04.01 mc y-2x=-1 and 2y-x=4 choose the correct graph of the given systems of equations

Answers

Answer:

1st one  m=0

y= 0.49875311x  / cm

No horizonal asymptotes

x= 1/2 + 2.005 mcy

2nd one is

slope 1/2

y intercept (0,2)

x      y

-4     0

0       2

Step-by-step explanation:

for 2

starting point ay y 2 make a point

then rise over run

go up 1 and to the right 2 and point , then up 1 and to the right 2 and point

there is your graph

4(c + 3) = t
solve for c

Answers

Answer:

c=1/4t-3

Step-by-step explanation:

Find the unit rate. Round your answer to the nearest hundredth.
3500 calories for 6 servings of pie

Answers

3500cals/6 servings

583 1/3 cals per serving.

583 calories per serving.

20 POINTS!
(Also explain the reasoning you used to find the expression)
ILL MARK BRAINLIEST

Answers

9514 1404 393

Answer:

  8x +96 yd

Step-by-step explanation:

The perimeter is the sum of the side lengths. In this case, it will be twice the sum of the overall length and the overall height.

The overall length is the sum of the two horizontal segments at top:

  (x -2) +(3x) = 4x -2

The overall height is the sum of the right-side vertical segments:

  10 + 40 = 50

Then the perimeter is ...

  P = 2(L+W) = 2((4x -2) +50) = 2(4x +48) = 8x +96

The perimeter is 8x +96 yards.

Solve 4q = 52
Q=
Which statement shows the correct justification for the step used to solve the equation

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]4q = 52[/tex]

Divide sides by 4

[tex] \frac{4q}{4} = \frac{52}{4} \\ [/tex]

Simplification

[tex]q = 13[/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

PLEASE HEEEEELLLPPPPP ILL GIIVE YOU BRAINLIEST

Answers

Answer:

your answer will be c

and distributive property for the second one

Step-by-step explanation:

the answer should be D for both, correct me if i'm wrong

what is the volume of a cylinder with radius 10cm and height 10cm?

Answers

Answer:

about 3141.59 cm^3

Step-by-step explanation:

V of cylinder = (pi)(r^2)(h)

radius = 10 cm

height = 10 cm

V = pi x 10^2 x 10

V = 3141.59 cm cubed

Parker is in the business of manufacturing phones. He must pay a daily fixed cost to rent the building and equipment, and also pays a cost per phone produced for materials and labor. The equation C=175p+400 can be used to determine the total cost, in dollars, of producing pp phones in a given day. What is the y-intercept of the equation and what is its interpretation in the context of the problem?

Answers

9514 1404 393

Answer:

  400; building and equipment fixed cost

Step-by-step explanation:

The cost equation has two terms. The constant term (400) is the daily fixed cost of building and equipment. The variable term (175p) represents the cost of producing p phones.

The y-intercept is 400. It is the daily fixed cost of the building and equipment.

Answer:

The y-intercept of the function is 400 which represents the fixed cost for rent and equipment.

Step-by-step explanation:

Since Parker must pay $400 even to make 0 phones, that means $400 is the fixed cost that Parker must pay for rent and equipment regardless of the number of phones produced.

Have a good day :)

Two bags of bird seed are used to fill these three bird feeders. How much bird seed does each feeder use? Represent the situation using the model. Then solve

Answers

Step-by-step explanation:

If two bags of bird seed are used to fill these three bird feeders, then we can say that;

2 bags of bird seed = 3 bird feeders

To know the amount of bird seed that each feeder use, we will say;

x bags of bird seed = 1 bird feeder

Equating both postulates and solving

2 bags of bird seed = 3 bird feeders

x bags of bird seed = 1 bird feeder

Cross multiply

3 * x = 2 * 1

3x = 2

subtract 2 from both sides

3x - 2 = 2-2

3x - 2 = 0

Hence model that represents the situation us 3x - 2 = 0 where x is the number of bird seed that each feeder use.

Next is to solve for x;

3x - 2 = 0

3x = 2

x = 2/3

Hence each feeder used 2/3 bird seed

8. Could an angle be complementary to itself? If, so what would it’s measure be?

9. Could an angle be supplementary to itself? If so, what would its measure be?

Answers

Answer:

8) angle that is complement of itself is 45°

9) When an angle is its own supplement, that means that the angle, plus itself, will equal 180 degrees.

Step-by-step explanation:

At a winter concert, the ratio of the number of boys to the number of girls is 3:8. if there are 250 more girls than boys, how many
boys are at the concert?​

Answers

Answer:

150

Step-by-step explanation:

if 3:8 , that means the difference is 5. the difference is 250, so 250/5 =50.

then u multiply 3 by 50 and get 150. ur welcome man

Anthony says that the expression abc has three terms because it uses three different variables. Critique Anthony's reasoning and explain whether he is correct.

Answers

Answer:

Anthony's reasoning is incorrect

Step-by-step explanation:

The expression abc is not made up of three terms because it is just an entity. For the expression to be called a three term expression, each of the variables must be separated using mathematical signs. For example, the expression a + b + c can be referred to as three terms because each variables are separated by a plus sign. In this case they are different entity.

From the above explanation, we can conclude that Anthon's reasoning is incorrect. The expression abc is just one term not three terms.

Other Questions
why did washington did not want political parties??why did jefferson did want political parties?? Which ion has smaller size and why?Mg++ or Na+. Which statement about Monsoons in South Asia is true?Question 1 options:They are seasonal winds that bring rain. They occur all year. Another term for them in Hurricane. They only occur in India Explain why the slope of the line drawn in part C must be negative. what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns