Adrenergic receptors Select one: a. can be activated by the release of epinephrine. b. have two structural forms - muscarinic and nicotinic. c. when activated stimulate skeletal muscles to contract. d. can be found in both the sympathetic and parasympathetic divisions. e. are activated by the release of acetylcholine.

Answers

Answer 1

Answer:

The correct answer is  a. can be activated by the release of epinephrine.

Explanation:

Epinephrine is a hormone and neurotransmitter naturally secreted by the body through the adrenal glands, synthesized and stored in the adrenal medulla and released into the systemic circulation. Epinephrine is a non-selective adrenergic agonist, stimulating alpha1-, alpha2, beta1, and beta2-adrenergic receptors. The systemic actions of catecholamines are mediated by the binding of these compounds to plasma membrane receptors, of the GPCR type widely distributed throughout the body and known as adrenergic receptors, which are activated by the catecholamines adrenaline (epinephrine) and noradrenaline . These receptors cause different effects depending on the G protein subtypes to which they are associated and the signal transduction mechanism linked to the specific G protein.


Related Questions

What could be inferred from suntans?

Group of answer choices

A tan might indicate sun damage to the skin.

Tanning produces healthier skin.

A tan strengthens the elastic in the skin.

Tanning makes skin look younger.

Answers

Answer:

A tan might indicate sun damage to the skin.

Explanation:

Tanning is the process by which the skin is exposed to the ultraviolet rays that comes from the sun with the purpose of producing a dark-brown coloration called a TAN.

A tan achieved by exposure to the sun can actually indicate that a person's skin is undergoing damage from the UV rays of the sun, hence, the skin responds by producing a protein called melanin, which protects the skin and later forms the dark coloration- tan. From this explanation, tan is got in response to a damaging signal received by the cell, hence, a tan might indicate sun damage to the skin.

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.


Which of the substances below are PRODUCTS of the overall chemical reaction of
photosynthesis?
A. ammonia
B. Unitrogen
C. carbon dioxide
D. water
oxygen
sugars

Answers

Answer:

essentially glucose and oxygen are the products of photosynthesis

Explanation:

What two taxon make up the scientific name? Pick all that apply.
Kingdom
Phylum
Class
Order
Genus
Family
Species

Answers

Answer:

genus and species are combined to form a scientific name

Answer:

GenusSpecies

Explanation:

The word is genus and species. These two taxon make up the scientific name.

hiii! ill give brainliest if u answer this :))

Why are enzymes important?

1. They contain the genetic material.

2. They speed up chemical reactions.

3. They bring water into the cell.

4. They help the cell maintain its shape.

Answers

They speed up chemical reactions

What is the source of the carbon dioxide that is used in photosynthesis?

Answers

Answer:

Photosynthetic cells

Explanation:

photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen

mango tree and Vanda ecological interaction​

Answers

Answer:

The relation between a mango tree and an orchid is commensalism. An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them.

hope it helps

Which best describes why gel electrophoresis works

Answers

Answer:

Scientists can determine the size of DNA fragments through a process known as gel electrophoresis. ... Large DNA molecules move slower and can be observed at the top of the gel, whereas smaller DNA fragments move faster and are seen at the bottom of the gel.

SCIENCE
Which of the following is an example of a glacial formation?
(Don’t put a random answer or spam things or I will report you and you will lose the points)
A. Photosynthesis
B. Methane degradation
C. Photolysis
D. Weathering of rocks

Answers

Answer:

The correct answers is letter D.

Explanation:

Base on my research Weathering of rocks or Weathering loosen of rocks are examples of a glacial formation

Why do potato plants no longer need to use glucose from starch in respiration once they have grown above ground?

Answers

They no longer need the respiration to grow

which two molecule do green plants use to make glucose

Answers

Answer:

Carbon Dioxide and Water

Describe the processes involved in photosynthesis

Answers

Explanation:

During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. ... Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.

Answer:

During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.

the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

species I
species II
species III
species IV

Answers

Answer: It’s species II because it matches the unknown


Which correctly describes the projected growth of the world's population in
the future?
A. The rate of growth will remain the same.
B. It will not grow much higher than it is now.
C. The population will eventually begin declining.
D. The rate of growth will slow down by 2100.

Answers

Answer:

D the rate of growth will slow down by 2100

Explanation:

Sorry if it’s wrong

World's population growth rate will slow down by 2100 in future.

What is world's  population growth ?The rise in the number of people in a population or dispersed group is known as population growth. Global population growth is roughly 83 million people per year, or 1.1 percent per year. From 1 billion in 1800 to 7.9 billion in 2020, the world's population has increased dramatically.

What will be the world's population growth rate in future?The world's population is expected to reach 10.9 billion by 2100 in future, with yearly growth of less than 0.1 percent – a significant decrease from present rates. Between 1950 and today, the world's population increased by 1% to 2% per year, going from 2.5 billion to more than 7.7 billion people.

Hence, the correct option is D.

To know more about population growth here,

https://brainly.com/question/17487289

#SPJ2

PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:

A. decomposers, B. producers, C. consumers, D. demagorgans

Answers

Answer:

a. decomposers

Explanation:

Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.

Macroscopic urinalysis collects data on all EXCEPT which of the following?
A. turbidity
B. color
C. pH
D. odor

Answers

Answer:

The correct answer is - pH.

Explanation:

Macroscopic urinalysis is the evaluation of the physical appearance of the urine. It evaluates the amount, color, odor and clarity, and other physical appearances or characteristics.

It also checks if there are any clotting, or sediments are found in the sample. It does not include the pH of the urine in the microscopic urinalysis. It is recommended to check underlying medical conditions.

I’m 98% sure it’s c but it might be B could someone check pls

Answers

Answer:

I think C

Have a great day

[tex]#Liliflim✌[/tex]

Answer:

Explanation:

A

Wich behavior is a response to an external stimulus

Answers

Answer:

An external stimulus is a stimulus that comes from outside an organism and causes a reaction. ... Learned behavior is a response to a stimulus that an animal was taught. Being able to read and write are examples of learned behavior, because it is not something you are born able to do.

Explanation:

The growth of two plant saplings A and B, were observed for a period of 6 months. The graph shows the linear growth of the saplings, in centimeters.

After how many months will the heights of the two samplings be the same?

Answers

5 is the correct answer I hope

Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.

Answers

Answer:

Its either a or b

Explanation:

A say the body can make all of the compound its need

my suggestion compound are made up of water ,mineral protein carbs and fat

our body produce little nutrients so we need to eat to get the nutrients we need

im am going with b

B is the answer

What molecule forms a double helix structure composed of two complimentary strands of nucleotides?

Answers

DNA! the question is a typical descrption of it


Question # 1: Which shape is CLOSEST to the truth for the shape of planet 1 point
Earth?
1. Which object best represents a true scale model
of the shape of Earth? (1) a table tennis ball
(2) a football (3) an egg (4) a pear
Option 1
Option 2
Option 3
Option 4

Answers

Answer:

(1) a table tennis ball

Explanation:

The earth will most closely resemble any type of sphere or circular ball.

Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

a

Explanation:

just did it

Answer:

the answer should be "B"

Please help me with please

Answers

no so do it yourself and get smart



What is the
Magnification
of a plant cell?

Answers

Answer:

400x

Explanation:

We don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
A. True

B. False

Answers

A. True

variation of reproduction produces diverse life forms and allows organisms to evolve complex characteristics over billions of years.

Answer:

A. True

Explanation:

Yeah, we don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.

Choose the combination of factors that creates snow.

Answers

Answer:

Relative Humidity- Low

Air tempurature-cold

Air Pressure-low

Explanation:

High pressure, warm temperatures, and high humidity are  factors that creates snow.

What are the factors that create snow?

Snow and/or ice formation requires temperatures below freezing, both in the atmosphere and close to the ground.

Something that will induce the moist air to rise, forming clouds and precipitation, moisture, produces precipitation and clouds.

Water that has frozen solidly is snow, and the atmosphere (layer of gases around Earth) contains water in the form of vapor (gas). When there is a lot of vapor present, clouds develop, fill up with water droplets, and eventually begin to rain.

Therefore, when a very cold water droplet freezes onto a pollen or dust particle in the atmosphere, a snowflake starts to form.

Learn more about snow, here:

https://brainly.com/question/29372094

#SPJ2

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

natural selection selects ___________ less fit individuals .
natural selection selects ____________ viable individuals .

Answers

Answer:

viable

Explanation:

Only the animals who are able to survive will live long enough to reproduce

Other Questions
Explica por qu la postura de la Iglesia no fue uniforme durante las independencias latinoamericanas? Y finalmente, en qu situacin qued la Iglesia Catlica en las nuevas repblicas latinoamericanas tras su independencia? At the insistence of Georgia and South Carolina, what clause from Thomas Jefferson's draft of the Declaration of Independencewas deleted before Congress approved the document? 2 coplas o pregones inventadas por ti relacionadas con la regin caribe. The graph of f(x) is the solid black graph below. Which function represents thedotted graph? Quantitative - Column chartQuantitative - Line chartQualitative - HistogramQualitative - Pie chart Tollowing statement.The type of rule in which you are given the first term and then your equation gives you a method for finding thenext term in a sequence. There are four pairs of different types of shoes in a bag: a pair of boots a pair of sandals a pair of sneakers a pair of flip-flops If you pick shoes from that bag (in the darkness), what is the minimum number of shoes you should pick to be certain that you will have a pair of matching shoes Write the expression in complete factored form.5c(a + 3) + q(a + 3) = . Indaga una resea y explica su contenido. Select the correct answer.What is the mood of the poem?A. indignantB. doubtfulC. overwhelmedD. conciliatoryTEXTfrom The Black Mans Plea for Justiceby Ephraim David TylerHear me, statesman,I am pleading to defendThe black mans cause.Will you give me the protectionto outline your laws?Will your lawyers plead my casesin your courts?Am I not a citizen?I pay dear for transportationover all your railroad track.I come up to every requirementand I will always pay my tax.And when I dont fill in blanks correctly,will you kindly teach me how?Ruling power of this nation,will you give me justice now?I prepared your wedding supperand I dug your fathers grave.I did everything you asked mejust because I was your slave.I helped build your great bridgesand I laid your railroad steel.Oh, I been a mighty powerin your great financial wheel.And when I dont do jobs correctlywill you kindly teach me how?Ruling power of this nationwill you give me justice now? the measure of an exterior angle of a triangle is greater than the measure of either of its remove interior angles One pair of parallel sides proves a quadrilateral to be a parallelogramTrueFalse A quadratic monomial with a leading coefficient of 6A linear binomial with a leading coefficient of 2 Given that A , B and C are the vertices of a triangle and that C B A = 80 and A C B = 35 , label the triangle with the correct vertices, A , B , or C . Select the correct answer from the options below. Ben was a pig. He was big and pink and very smart. He lived in a barn with a cow and a hen. When the farmer would ring a bell, Ben wouldeat his dinner. After dinner, Ben would go to sleep. Then he would walk outside.When did Ben eat dinner?O 1. when a bell was rungO 2. after he slept3. when he went outsideO 4. in the morning The expression 1/2 bh gives the area of a triangle where bis the base of the triangle andH is the height of the triangle. What is the length of the side x? Put in in order from least to Greatest 3,-18,5,4,-2,6A)-2,3,4,5,6-18B)-2,18,3,4,5,6C)-18,-2,3,4,5,6D)3,4,5,6-2,-18 Find the area of a circle with radius 2cm, leave your answer in terms of pi A toddler weighs 10 kg and raises herself onto tiptoe (on both feet). Her feet are 8 cm long with each ankle joint being located 4.5 cm from the point at which her feet contact the floor. While standing on tip toe:(a) what is the upward normal force exerted by the floor at the point at which one of the toddler's feet contacts the floor?(b) what is the tension force in one of her Achilles tendons? (c) what is the downward force exerted on one of the toddler'sankle joints?