An object has a mass of 5 kg. What force is needed to accelerate it at 6 m/s2? (Formula: F=ma)
Group of answer choices

A. 11 N

B. 30 N

C. 1.2 N

D. ,83 N

Answers

Answer 1

Answer:

A

Explanation:

if you calculate 6 m/s2 and 5 kg you get 10N

but you have to round and you get 11n

Answer 2

Answer: 30

Explanation:

5 x 6 = 30


Related Questions

Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?

Answers

Idk for sure but the first one seems like the best choice :)

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

what is this pls help these are finals

Answers

Answer:

wowzerrrrrrs

Explanation:

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

NEED HELP ASAP!!!! Explain why the fact that invasive species did not co-evolve with the native species unbalances an ecosystem.

Answers

Answer: The invasive species unbalance an ecosystem because it takes over an ecosystem and does not let the other native species thrive while it takes over. There are many invasive species around the world even in your own town or state there is a type of fish suppose that is an invasive species to Michigan called a sea lamprey which kills fish native  to the great lakes and is taking over there are also zebra muscles if you need another example

BRAINLIEST PLZ

            Invasive species lack native species' population controls, such as predators, because they did not co-evolve with the other species in the ecosystem. As a result, the population of an invasive species may spread unchecked and eventually throw an ecosystem out of balance.

Unbalances in ecosystem :

                 A natural or human-caused disruption that throws off an ecosystem's natural balance is known as an ecological imbalance. Both natural and man-made disturbances have the potential to upset an ecosystem's delicate balance. A species' extinction or the introduction of a new species may cause an ecosystem to become ecologically unbalanced.

                 All the organisms and the physical setting they interact with make up an ecosystem. The nutrition cycles and energy flows connect these biotic and abiotic elements. Photosynthesis is how energy enters the system and is absorbed by plant tissue. Both internal and external influences influence ecosystems. External variables that do not directly affect an ecosystem, such as topography, parent material that creates the soil, and climate, control the ecosystem's general structure. For instance, decomposition, root competition, shade, disturbance, succession, and the kinds of species present all regulate internal variables. While the availability of these resources within the ecosystem is normally governed by internal factors, the resource inputs are often controlled by external activities. As a result, interior variables influence ecological processes as well as being influenced by them.

To learn more about ecosystem refer :

https://brainly.com/question/842527

#SPJ2

someone Please help!! I'm not good at this stuff. I'll give brailniest

Answers

Answer:

What do you need help with?

Explanation:

how would you classify the bloody fingerprint found in the pedro ramon velasquez case?
patent
latent
delta
plastic

Answers

Answer:

patent

Explanation:

what was the problem with reusing contaminated water from other parts of the mill to extinguish the coke fires? From the book ‘When smoke ran like water’

Answers

Answer:

1. The problem with that was that the already poisonous water was made worse after using it to quench the flames from coke production.

2. It contaminated the soil, making it difficult for plants to grow.

Explanation:

As the author described the last stages of coke production, she explained that water was needed to quench the very hot flames from coke production. A 'bright fellow' suggested using dirty water from other parts of the mill to quench the flames from the coke production. The problems with this were;

1. The already contaminated water was made worse after it was used to quench the flames from coke.

2. Mrs. LaMendola noted that she was unable to grow her tomatoes in the path where the plumes from the oven ran. So the contaminated water negatively affected the soil.

The problem that should be already poisonous water is also made worse when it quenches the flames at the time when the production of the coke should be done.

Also, it contaminated the soil also it is difficult for growing the plants.

The problem of reusing contaminated water:

Since the author explained the last coke production stage so here the water required to quench that it should be very hot flames arise from the coke production. Also, the contaminated water should be worse whenever it is used for quenching the flames. Also, the contaminated water does not positively impact the soil.

Learn more about water here: https://brainly.com/question/18850280

According to the graph below, at which point is the plant preforming the most photosynthesis?

A. Point D.
B. Point B.
C. Point C.
D. Point A.

Answers

Answer: C

Explanation:

Point c would be the answer to your question

How is the DNA code itself a homology?

Answers

Answer:

Explanation:

These fundamental similarities are most easily explained by evolutionary theory: life shares a common ancestor. ... In fact, the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

Answer:

the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.


Which type of energy
does respiration release?
chemical
thermal
potential
kinetic

Answers

Answer:

Respiration releases energy it is an exothermic process. The energy is stored in molecules of ATP . ATP can be broken down in other processes in cells to release the stored energy.

chemical

Describe how energy flows through an energy pyramid? Write your answer in the space provided below.

Answers

Answer:

Depending on the food pyramid, on the side there may be something that says decomposers. These eat from all of the sections of the pyramid.

Energy flows from the bottom to the top, and then to the side with the decomposer.

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

struggling in bio h e l p

Answers

Answer:

d maybe but im still figuring it  out

Explanation:

Answer:

D

Explanation:

Which one is the correct answer?? The lined squares in the Punnett square represent____.

Answers

They represent the parent's genotypes.

Which are different forms of the same gene?
A.genotypes
B.phenotypes
C.alleles
D.traits

Answers

Answer:

alleles

Explanation:

An allele is a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. Humans are called diploid organisms because they have two alleles at each genetic locus, with one allele inherited from each parent.

Answer:

C. alleles

Explanation:

edge 2021

Who were the representatives
sent to work on the deal?

Answers

Answer:

Peace Negotiations

After Yorktown, the Continental Congress appointed a small group of statesmen to travel to Europe and negotiate a peace treaty with the British: John Adams, Benjamin Franklin, John Jay, Thomas Jefferson and Henry Laurens.

Paragraph about Photosynthesis

Answers

Answer:

Photosynthesis is the process of making food by green plants in the presence of sunlight.

Explanation:

During Day, sunlight enters through stomata and carbon dioxide from air and water forms glucose and oxygen. This process is photosynthesis.

What are the two categories that Igneous Rocks can be classified into?
How do you tell them apart?

Answers

Igneous rocks are divided into two groups, which penetrate or expand, depending on the strength of the molten rock.

Intrusive Igneous Rocks: Intrusive, or plutonic, is an empty rock that occurs when magma is trapped in the depths of the Earth.Extrusive, or volcanic, igneous rock is produced when magma exits and cools above the Earth's surface.

hope it helps!

describe some of destructive action of microbes ​

Answers

Answer:

A microbe is a small living thing too tiny to be seen by the naked eye and includes bacteria, fungi and viruses. Among their destructive actions is causing diseases in human beings and their livestock or plants, destruction of food by causing decomposition which might lead to hunger and other related calamities. Despite this destructive consequences, microbes are also known to have advantageous actions like helping in sewerage treatment, microbes found in the gastro-intestinal tract help in maintaining a good environment for digestion to take place. Microbes also help in ecological balance by causing decomposition of dead matter hence conserve the environment.

Explanation:

Answer:

see the attached photo

Who is the inventor of the modern classification system?

Answers

Answer:

Carolus Linnaeus

Explanation:

Answer:

Carolus Linnaeus

Explanation:

The last universal common ancestor (LUCA) probably multiplied by duplicating all of its cellular contents, followed by cellular division .

Answers

Answer: true

Explanation:

i guessed and got it right

which factor would increase the production of glucose by photosynthesis

Please help!!!

Answers

Answer:

freezing temperatures

The amount of sun it’s getting

The plates include the lithosphere under the oceans true or false

Answers

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere. So i think its True

Which process is best illustrated by the diagram?

Answers

Answer:

Photosynthesis

Explanation:

The formula shown is the one for photosynthesis.  6CO2 + 6H2O → C6H12O6 + 6O2. (please tell me if i am correct) :)

Which American Indian group was allied with the British as the French and Indian War began?
A)the Huron
B)the Ottawa
C)the Iroquois Confederacy
D)the Algonquin

Answers

Answer:

The Iroquois Confederacy would be your answer.

hope it helps!

Why must an organism be able to adjust to changing environments?

Answers

Answer:

blabkkbkkbcqcwwcqwqwwq

Explanation:

All organisms need to adapt to their habitat to be able to survive. This means adapting to be able to survive the climatic conditions of the ecosystem, predators, and other species that compete for the same food and space.

What happens if oranisms fall to adjust and respond to changes in their environment?

Answers

Answer:

they would probably go extinct

Explanation:

I’m assuming the whole environmental system would collapse animals would die off including humans

Joseph and Molly each have coin collections. Joseph starts with 15 coins in his collection and adds 25 coins each month. Molly starts with 25 coins in her collection and adds 25 coins each month. If Joseph and Molly continue to collect in this way, how many coins will each person have after 10 months? Enter your answers in the boxes. After 10 months, Joseph will have coins in his collection, and Molly will have coins in her collection.

Answers

Answer:

Joseph will have 265 coins and Molly will have 275 coins after ten months.

Explanation:

Joseph already has 15 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]15+25\times 10=265[/tex] coins.

Molly already has 25 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]25+25\times 10=275[/tex] coins.

So, Joseph will have 265 coins and Molly will have 275 coins after ten months.

Help me ASAP please

Answers

Answer:

C

Explanation:

Other Questions
What is the scientific notation for 3,470 How were Ray Kroc and Walt Disney similar?A. They both had an obsession with cleanliness.B. They both considered themselves socialists.C. They were both born in Southern California.D. They both came from very wealthy families Compared to ionic compounds, molecular compounds generally have A. stronger chemical bonds. B. poor conductivity. C. a high melting point. D. lower densities. The term inadequacy refers to:______A. The inability of a plant asset to meet its demands. B. An asset that is worn out. C. An asset that is no longer functional. D. The condition where the salvage value is too small to replace the asset. Find the zeros of the polynomialfunction and state the multiplicity ofeach Spencer bought gas for his four-wheeler from Gas World on Saturday. On Sunday, he bought the same amount of gas from Fuel Stop for less money. Now, Spencer has $20 to spend on gas for his car. Fuel Stop is on his way home. If the gas prices haven't changed, will Spencer be able to get more or less gas at Fuel Stop than at Gas World? Select all of the expressions that are equivalent to 8/5.A. 5 x 1/8B. 8 x 1/5C. 2 x 4/5D. 4 x 2/5C. 2 x 6/5 Who was ambassador to Great Britain?O John HancockO John RolfeO John AdamsO John Jay plzzzzzz help me!!!!!!!Flowers may seem beautiful to some, but beauty is in the eye of the beholder. Casual walkers in rural and urban areas in Alberta may enjoy the vibrant purple flowers of the purple loosestrife plant, but the trained eye of an ecologist sees the threat this invasive species poses.Purple Loosestrife InvasionPurple loosestrife was not always seen in and around Alberta. In fact, it wasnt found anywhere in North America before the 1800s.During the 1800s, ships transporting goods around the world were sometimes without cargo for a time, particularly when they were heading to collect a new load. Wooden ships dont balance well when they are empty, so when they were without a cargo, they were often filled with ballast instead.How does this relate to purple loosestrife in Alberta? Well, purple loosestrife is a naturally-occurring plant in Europe and Asia, which means that their seeds may become mixed in with the soils found there. Ships sailing from Europe and Asia to North America without cargo often used soil as ballast to maintain the balance of the ships, and then dumped the soil when they arrived to pick up their cargo. It is believed that this dumped soil introduced the purple loosestrife species to Canada.It may also be the case that early settlers brought purple loosestrife with them when they settled Canadas west.Purple Loosestrife: A Not-So-Welcome IntroductionSo whats the big deal about having purple loosestrife in Alberta? Well, purple loosestrife is not a species of plant that occurs naturally in the province- it is an introduced species. Organisms that dont occur naturally in an area but are instead brought from elsewhere are categorized as introduced species.Again, whats the big deal about that? Well, organisms that are introduced to an ecosystem may become invasive - think: invader! An invasive species is defined as any organism that reproduces so quickly or grows so aggressively that it becomes a problem for the other organisms around it. Invasive plant species tend to outcompete local plants for resources such as sunlight, water and root space. In this way, invasive species can harm ecosystems by taking over, disrupting food webs and decreasing biodiversity.Purple loosestrife has invaded local wetlands and is often found growing unchecked in other wet areas of the city. It flowers prolifically, producing millions of seeds each year. These seeds have many vectors of dispersal, for example, they may be blown to new places by the wind (aerochory), travel along with moving water (hydrochory), hitchhike in animals fur or be deposited in animal waste (zoochory), and even planted intentionally by humans.Purple Loosestrife: Super-plant!Purple loosestrife grows in clumps with a dense root system that extends underground like a living mat - its like a super villain, soaking up nutrients and taking over the space where other plants might grow. In wetlands, waterflow can be disrupted as waterways become clogged.Over time, purple loosestrife becomes the dominant plant in an area and other plants disappear. This disrupts the food web because animals that only feed on the plants that disappear, disappear too. Once a plant disappears and the animals that feed on that plant disappear, there is a ripple effect along the food chain. Animals that can adapt to their food source disappearing by switching to a different food source will survive, but those that dont adapt either move to a different habitat or die.Waging War on Purple LoosestrifeIn Alberta, purple loosestrife is classified as prohibited noxious, which means that it is not allowed to be planted and any plants that are found must be destroyed. In many Alberta cities, crews are sent out to dig out and destroy clumps of loosestrife that are reported.Another way that purple loosestrife has been kept in check across Canada is through the use of biological controls (when one living organism is used to control another). Beetles such as the black-margined loosestrife beetle feed on purple loosestrife, so they are the plants natural enemies - perfect for biological control. Releasing the black-margined loosestrife beetle can reduce the purple loosestrife population in an area significantly. When an invasive species is controlled, often the original plants can re-populate and the ecosystem can return to a balanced state.Using Text Features to Predict InformationScan the nonfiction text to find the text features listed. Use clues from each text feature to predict what you will learn from the text and jot down your prediction beside each text feature.Text Features What I think I will learn about based on...Title or HeadingSidebarsDirect Quotation:Main Idea:Supporting Details:Direct Quotation:Main Idea:Supporting Details: Point B is at (-1.5 , 6.3). Point B is reflected across the x-axis to become point C. The coordinates of point C are___________ .Point C is located in quadrant _________ .PLS HELPBRAINLIST Help please anyone you guys are the best HURRY PLS Which of the following does not contain carbon from the bodies of plants and animals that died millions of years ago? Four times the sum of a number and seven is twenty three. What type of solution would you get for 0=0A. one solutionB. no solutionC.infinite I need help pllssss Can you help me in this question Find the sale price. Round to the nearest cent. regular price: $49.71 percent of discount: 20% What is the best way to come out to your parents? Can someone tell me the answers 4,5,6,7 No wrong answers plz this a 30 quiz Diana hangs a lead cylinder with a force of 12 N from a model bridge.Which vector(s) accurately illustrates the reaction force of the bridge on the lead cylinder?