Drag each label to the correct location on the table.
Correctly identify the main idea and the supporting details.
Print and television media must limit
their content for the fear of lawsuits.
They have to maintain credibility, which
bloggers do not have to worry about all
of the time.
Independent bloggers can offer their
opinions on current events without
the fear of being fired or jeopardizing
ratings
Blogs have managed to create a
niche for themselves because they
have more creative freedom than
print and television media.
A lot of newspapers and news channels
have started maintaining blogs to keep
up with the rapid flow of information on
the Internet.
main idea
supporting idea

Drag Each Label To The Correct Location On The Table.Correctly Identify The Main Idea And The Supporting

Answers

Answer 1

Answer:

the one on the top left and bottom right are main and the top right and bottom left are supporting

Explanation:

Answer 2

Explanation:Hope this help

Drag Each Label To The Correct Location On The Table.Correctly Identify The Main Idea And The Supporting

Related Questions

11. What is the central idea of the text?
A Black holes' strong gravitational force poses a
serious threat to Earth.
OB Black holes are invisible and are located
unpredictably throughout space.
OC Black holes develop from tightly compressed
matter and have strong gravity.
OD Black holes develop from dying planets and have
a weak gravitational force.

Answers

Answer:

I wanna say B but I’m not sure

Explanation:

B is what the passage talks about and goes more in depth about so ..

hello can you help me plz​

Answers

Answer:

is it C?

Explanation:

"Source of those fights is older than the bricks of this building but nobody's doing they research. You got a bunch of parents. Teachers. Politicians. Whoever. Trying to understand these kids. But how you gonna understand a book you only skimming?"

Answers

Answer: To understand a text, book, or article, we can use the reading technique of skimming, which is reading for the main idea and picturing the rest with logic and reasoning. Therefore, for someone to understand the source of those fights, skimming is a useful tool.

Explanation: Skimming is a reading technique that helps the reader understand the main ideas of a text. It is known for being a fast and simple technique that doesn't require much time. However, If done efficiently, a reader will be able to understand what the text is trying to convey. Thus, to understand the fights and not waste too much time, the person must skim several sources, look at pictures, headings, and topic sentences, so that the important information can be inferred by using logic and reasoning.

Write an antonym for each of these comments made about a buffet dinner. Preposterous, Gigantic, Extravagant, Fetid, Superfluous, Colossal.​

Answers

Answer:

preposterous-reasonable

gigantic-tiny

extravagant-thrifty

fetid-fragrant

superfluous-neccesary

collosal-tiny

Explanation:

if you think its wrong dont answer

Authors of science fiction novels use suspense to keep the reader engaged in the story. Analyze the structure of the story to determine how the author of "War of the Worlds" uses Ogilvy's encounter with the meteorite to increase suspense for the reader. Use evidence from the text to support your response.

Answers

Answer and Explanation:

The author structures the text so that the reader perceives Ogilvy's curiosity with the meteorite, which has caused him to observe it from a distance, but concentrated in all its form. His curiosity is what triggers the suspense, because anything can happen while he watches the meteorite and it really happens, since he sees something moving, like a lid being pushed by someone who wants to get out, escape from inside the meteorite. Ogivly doesn't know what it is and it stimulates suspense and causes Ovigly to exclaim "" Good heavens! " [...] "There's a man in it — men in it! Half roasted to death! Trying to escape!" "

give a way 30yeeeeeeeeeeyyyyy

Answers

Answer:

thx soo much

Explanation:

Please help me:) I'd appreciate your help​

Answers

Answer:

He uses light as guidance

Explanation:

HELP ME
I spent my Saturday the best way I know(how)running around in the park
with my dogs.
A.how:
B.how;

Answers

The Answer would be A

What is the answer now the correct one

Answers

Answer:

Joe worried about his entrance.

Explanation:

does rhythm always involve pitch

Answers

Answer:

Yes.

Explanation: Because without pitch then rhythm which is sounds in pattern wont have any sound since pitch is the highness and the lowness of the sound.

yes because they go hand and hand

lily works daily in a library because she wants to be a writer one day.

Answers

Answer:

What is the question?

Explanation:

Answer:

It's good that Lily knows what she wants to do with her life.

Explanation:

describe what jacob marley looked like when he appeared in front of scrooge

Answers

Answer:

When Scrooge first witnessed the ghost of his old friend, he saw the same face as he had seen in his door-knocker: ... the very same. Marley in his pig-tail, usual waistcoat, tights, and boots; the tassels on the latter bristling, like his pig-tail, and his coat-skirts, and the hair upon his head.

Explanation:

I looked it up on Google and it’s the right answer okay don’t forget to like

What part of speech is the word in italics?
Brian walked slowly home, as the day was so warm and pleasant.
O Noun
O Verb
O Adverb
O Adjective
Walked is in italics

Answers

Answer:

Verb my guy :))

Explanation:

It’s a verb easy questions

Which excerpt from “Lessons of Dr. Martin Luther King, Jr.” by Cesar Chavez provides evidence that Dr. King promoted nonviolence?

He once stopped an armed mob, saying: "We are not advocating violence. We want to love our enemies. I want you to love our enemies. Be good to them. . . .”
But he said, "If I am stopped, the movement will not stop. If I am stopped, our work will not stop. For what we are doing is right. What we are doing is just. . . ."
Dr. King's dedication to the rights of the workers who are so often exploited by the forces of greed has profoundly touched my life and guided my struggle.
The enemies of justice want you to think of Dr. King as only a civil rights leader, but he had a much broader agent.

Answers

Answer:

I think A

Explanation:

Answer:

A

Explanation:

did the test

Lin-Manuel Miranda does not include a focus on George Washington as a slave owner in Hamilton. How does this affect your interpretation of Washington’s character?

Answers

Answer:

it will make you see him in a better more biased light

Explanation:

Answer:

It doesn't really affect me.

Explanation:

[tex]--------------------------------------------[/tex]

It doesn't really affect my interpretation because he is being seen in a more positive way, this is because they do not talk about the slaves that George Washington owned in the 1700 and / or 1800s. They probably didn't add it because it wouldn't go with the song or they probly couldn't add it in because there are already too much stuff, those are my guesses, and I have one more, they did not add it because it would make the story "dull" or not interesting. Which comes to my conclusion, "It doesn't really affect me."

[tex]--------------------------------------------[/tex]

Hope this helps! <3 [tex]--------------------------------------------[/tex]

C. Activate yourself
Now it is your turn. Express your views on the topic "Word is Stronger than
Sword”.​

Answers

Answer:

Well its a often heard thing.

Explanation:

Words can cause more damage than the sword. The intellectual doesn't picks weapon but they pick pen, the sword that doesn't make destroy you at once, the sword which can't reverse its effect, a sword which cannot be used by everyone. The sword of the intellectual is the pen.

Governments were build, they fall. Monarchies were formed and were uprooted, rules were made and were broked. Peace happened and wars ended, this is what we can say is the strength of this 10 cm sword, the sword which cannot be used with irresponsibility of thoughts, its for the pure form of genius and not any day one guy. Men and women have made history on its nib, the world today at points stays free or captive by the nib of this sword. This is what the power of words are, that comes out of it.

On this day in 1955, Rosa Parks refused to give up her bus seat. This was a brave action by Parks. What is the bravest thing you've ever done? Be sure to include details about the event and why you think you were brave.
5-7 sentences

Answers

Answer:

I just wanted the point

Explanation:

dont get mad

can a 13 years old date a 12 years old

Answers

Answer:

Yeah thats only one year, If they were 15-18 I would say hell nah. I SAY GO FOR IT DUDE

Explanation:

Answer:

Sure it is who you love that makes it special not age.

Explanation:

But Iḿ not telling you to be a Ped0 tho... lol

12 PTS FOR WHOEVER GETS IT RIGHT PLEASE HELP ME OUT RQ
Match the definition to the term.
1 modifies adverbs, verbs, and adjectives
adverb
2. exchange of ideas
verb
3. European parent languages
Aramaic
29
4. predecessor of Greek
communication
5. refers to subject
analytical
6. logical
dialect
11
7. language spoken by mountaineers
philologist
Indo-European
8. expresses state of being
reflexive pronoun
9. person, place, or thing
Hellenic
10. the language many Jews spoke
9
noun
11. scientist who studies languages
dominion
12. supreme authority

Answers

Answer:

12. supreme authority  is correct

Answer:

 

Explanation:

 

Explanation:

What does correct enunciation mean? A. speaking clearly B. speaking slowly C. using effective vocabulary D. using grammatically correct language

Answers

definitely a i think

What was the cause of the yellow fever epidemic described in The American Plague?
A.Jefferson
B.mosquitoes
C.war
D.Washington

Answers

Answer:

the anwser is b

Explanation:

Answer:

The Answer is B Mosquitoes

Explanation:

Because The first yellow fever outbreaks in the United States occurred in late 1690s. Nearly 100 years later, in the late summer of 1793, refugees from a yellow fever epidemic in the Caribbean fled to Philadelphia. Within weeks, people throughout the city were experiencing symptoms. By the middle of October, 100 people were dying from the virus every day. Caring for the victims so strained public services that the local city government collapsed. Philadelphia was also the seat of the United States government at the time, but federal authorities simply evacuated the city in face of the raging epidemic.

Eventually, a cold front eliminated Philadelphia’s mosquito population and the death toll fell to 20 per day by October 26. Today, a vaccine prevents yellow fever in much of the world, though thousands of people still die every year from the disease.

When Mr. Hadley asks about Africa, the children… explain why they were thinking about Africa. Apologize for thinking about death. Claim that Africa isn't in the nursery. Avoid his questions about Africa.

Answers

Answer:

Claim that Africa isn't in the nursery

Explanation:

According to The Veldt, the family of Hadley live in a plush home called The Happy life Home and eventually, the parents are concerned with their children's fascination with their "nursery" which is an extended virtual reality room that can eneble them create their own reality.

When Mr. Hadley asks about the African continent, the children claim that Africa isn't in the nursery.

Can someone explain to me. I don’t need the answer I just want like explaining because I’m confused on this question.

Answers

Answer:

It's just saying do you think people like being around u for long periods of time

Explanation:

Answer:

Ok so like its asking if you are a tolerant person or do you accept other people's different beliefs and ideas even if you dont agree with them?

Explanation:

Mildred is waiting for her friends to come over to watch something. What
is it?
A. A football game
B. The fireworks
C. Their new screen is getting installed
D. White clown

Answers

Answer:

I think it’s (d) white clown not sure

Explanation: hope this helps!

How do sad moods affect people's thinking?(the bright side of sadness) a They make people think creatively. b They make people think in a detailed and critical way. c They make people think in a loose and unfocused way. d They make people focus their attention on how to be happy.

Answers

Answer:

b they make people think in a detailed and critical way

Sad moods affect people's thinking as they make people think in a detailed and critical way. Thus, option B is correct.

What is the mood?  

The emotional mood created by the author's word choice is known as mood. Pay a close look at the way that authors portrays the circumstances, the environment, how a personality responds to the situations, and how the tension or issue is ultimately resolved or all the negative aspect.

If a person is a mood is sad and is thinking very much just will affect his mental health. Whenever a person has said he evaluates things in depth and in a critical manner. It depends upon the what if a thing or what if there would be another decision that could be taken. This happened is feeling low. Therefore, option B is the correct option.

Learn more about mood, here:

https://brainly.com/question/27450024

#SPJ5

What do Lina and Cesar teach Marie to do at the end of the story?

Answers

Answer: lina teaches cesar and marie

Explanation:

Answer:

Lina and Cesar teach Marie how to steer the boot at the end of the story.

Short script writing

Answers

what do you mean by “short script writing?”

how does internet connection cause poor academic results?
Please give a meaningful answer, this is for an essay.​

Answers

Answer:

takes away attention

Explanation:

if you have poor internet connection it will take longer for you to be able to do your academic work therefore you loose your train of though in which leads you to your demise.

"The settlers in the westward movement started in the east, and then they moved in wagon trains across trails like the Oregon Trail to the west" is an an example of a ___________ sentence.

compound
clause
simple
conjunction
cause and effect

Answers

Answer:
Conjunction sentence.

find the errors:
Perhaps the most fussy eater in
the world is the beloved koala
bear of Australia, whom won't
eat nothing accept eucalyptus
leafs.

Answers

The problems you see: is where is says “won’t eat nothing accept” when it should be “won’t eat anything accept”

ALSO it should be spelled leaves, not leafs.
Other Questions
Which of these sentences is the best definition of "verb tense"?where things happenwhy things happenwhat happens to a characterwhen things happen what is 5 1/3 as an improper fraction?? Solve for x.And please show me how u got the answer 9124x - 2)3x + 2 Comparing FunctionsHow much money will Bob in December have if his bank account growth stays at the same rate?Month Bank-Acc |January | $5,000February $6,700March $8,400April $10,100May $11,800 Which country closed its ports to farmers?A. SpainB. FranceC. England Can you help me plz? Write an equation in point-slope form for the line through the given point with the given slope(8,-3);m= -1/4 a drum has a diameter of 18 in and is 16 in deep find the volume What is the special rule with multiplying or dividing an equality by a negative number? (Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town?