En una hoja de papel y tu compañero escriban diez cosas que quisieron hacer el fin de semana pero no pudieron. Write in Spanish.

Answers

Answer 1

Answer:

Quería ir al cineQuería ir al conciertoQuería jugar en el parqueQuería cortar el céspedQuería ir a la clase de nataciónQuería comer pizzaQuería jugar videojuegosQuería lavar el carroQuería reparar el televisorQuería pasear con mi perroQuería caminar por la montaña.

Explanation:


Related Questions

hello how are you today

Answers

Answer:

Hola, como esta usted hoy?

Explanation:

Answer:

Hola, cómo estás hoy

Hace un año compré unos patines pero nunca ________ uso porque trabajo demasiado.
a las
b la
c lo
d los

Answers

D: Los

Explication:
The word “Los” means “Them”. The sentence that you put was “A year ago I bought some skates but I never use THEM because I work too much”

(Hope this helps :D)

En los países del Cono Sur, como en otros países de Latinoamérica, se ve gente con rasgos indígenas, europeos y de raza negra. Basándote en esta información, ¿qué ocurrió en el pasado de Sudamérica?

los europeos fueron a Argentina para degustar tapas
personas de África abrieron ventas para indígenas y españoles
diferentes culturas convivieron en estos países
los indígenas cavaron la tierra hasta llegar a Chile

Answers

Diferentes culturas convivieron….
(Diferentes culturas convivieron en estos países)

Lee y escoge la mejor opción para completar la frase. Read and then choose the option that best completes the sentence.

________ es una pequeña cantidad de dinero que debes pagar cuando se utiliza un servicio médico. (1 point)

a
El copago

b
El derecho

c
El impuesto

d
El seguro

Answers

Answer:

a. El copago.

Explanation:

El copago es una pequeña cantidad de dinero que debes pagar cuando se utiliza un servicio médico.

Oraciones ilógicas
Edit the sentences so they make sense. Follow the model below.
La muerte es el principio de la vida.
El nacimiento es el principio de la vida.

1. Mi abuela murió y ahora mi abuelo es separado.

2. Una chica que celebra sus quince años está en la etapa de la madurez.

3. Ricardo y Marta se comprometieron porque quieren divorciarse.

Answers

1. “My grandmother died and now my grandfather is separated”

2. “A girl celebrating her fifteenth birthday is in the maturity stage.”

3. “Ricardo and Marta got engaged because they want to get divorced.”

(i’m not sure if you wanted to know the sentences or not but i tried my best:) )

1. ¿Donde se pone los difuntos?

A) En un aguinaldo
B) En un camposanto
C) En una ofrenda

Answers

Answer:

En un camposanto

B. En un camposanto

please do this brainly https://brainly.com/question/22806850
heres the images for it

Answers

Answer:

4  

   1. ¿Qué ropa llevas puesta cuando montas en bicicleta?

       Llevo puesto mi casco, coderas, rodilleras y ropa con colores muy llamativos para que todos me vean.

   2. ¿Qué ropa llevas puesta cuando tienes calor?  

        Llevo ropa muy ligera: una camiseta u pantalones cortos.

    3. ¿Qué ropa llevas puesta cuando practicas deportes?  

        Llevo tenis, una camiseta de algodón para absorber el sudor y pantalones cortos

     4. ¿Qué ropa llevas puesta cuando tienes frío?  

          Llevo una chamarra, pantalones de mezclilla, calcetas de lana y botas para clima frío.

      5. ¿Qué ropa llevas puesta cuando vas a la escuela?  

            Llevo mi uniforme escolar una chamarra por si acaso hace frío o llueve.

       6. ¿Qué ropa llevas puesta cuando vas a un concierto?  

            Llevo puesta una playera alusiva al cantante o grupo que se va a presentar.

5  

Maribel quiere el vestido anaranjado

Tú quieres la blusa blanca

Vosotros queréis la camisa amarilla

Usted quiere las sandalias obscuras

Yo quiero el pantalón de mezclilla azul

Los amigos de Maribel quieren el pantaloncillo verde

Mis amigas y yo queremos los zapatos cafés

Ustedes quieren las medias ralladas de naranja y negro

6  

quiere una chaqueta nueva

piensa

entienden

empieza

prefiero

cierra

Explanation:

Make a list of 5-8 objects in your house, and write who bought them and for whom. Include other details if possible.
Por ejemplo: la pelota- Mi mamá me la compró.

Modelo; espejo italiano
Mi madre me lo compró en Roma.

Answers

Any specific verbs to use?

PLEASE HELP NEED DONE SOON!!!!

Answers

Answer:

Es la comida más rica que he probadoEs la mejor música que he escuchadoEsta sala es enormeVicente parece ser mudoEs la chica más bella de la ciudadSon unos invitados con mucha claseEl pastel está riquísimo Las decoraciones son excepcionales

Explanation:

Please help spanish midterm

Answers

it’s correct! the answer is yes

brainliest for a right answer

Answers

Answer: 1 esa 2 esos 3 esa 4 esa 5 ese 6 esos 7 esas

Explanation:

Whats 'they went camping' in Spanish?

Answers

Answer:

Fueron a acampar

Explanation:

(Ellos, ellas, ustedes)  "Fueron a acampar"

help out I'll mark brainliest

Answers

Answer:

3- los traigo?

4- los lavo?

5- lo compro?

Explanation: If im wrong please correct me. Also I dont understad the insructions to the second exercise

Answer:

1. La limpio

2. Lo pongo

3. Los traigo

4. Los lavo

5. Lo compro

Explanation:

This is for the first image, for the second I don’t understand well. I’m from Colombia so I can understand spanish

Gloria Santos __________ Nicaragua.

Answers

Answer:

vive

Explanation:

Vive

Espero que te sirva

I need the answers like ASAP please help

Answers

I cant see what its asking, its really small

Identify what is being described in each item​

Answers

Where is the picture? Or the problem that has to be solve?

described by which the sentence carefully choose the underlined phrase

Explanation:

identify the word or two at a big deal for your paperwork

Combine elements from each column to describe what everyone is going to do this weekend. Write
six sentences.
Modelo
ustedes - pasear por el parque - el fin de semana
Ustedes van a pasear por el parque el fin de semana.
A
B
с
ustedes
ver películas
el domingo
nosotros
ir al estadio de fútbol
el fin de semana
Victor
tomar el sol
al mediodía
Claudio y su primo visitar monumentos
a las tres
w

pasear por el parque
por la noche
yo
comer en el restaurante por la mañana

Answers

1. Ustedes van a ver películas en domingo
2. Nosotros vamos ir al estadio de fútbol el fin de semana
3. Víctor va tomar el sol al mediodía
4.Claudio y su primo van a visitar monumentos a las tres
5. Tú vas a pasear por el parque por la noche
6. Yo voy a comer en el restaurante por la mañana

Please help. Any answer is fine as long is it makes sense

Answers

I can't help you because the answers depend on what each one does in their daily life

Determine if each statement is Cierto or Falso

Answers

Answer:

1. Falso

2. Cierto

3. Falso

4. Cierto

5. Falso

Explanation:

1. Falso
2. Cierto
3. Falso
4. Cierto
5. Falso

Write complete sentences, changing the direct object to its pronoun form.

1. Yo tengo los libros en mi mochila.
2. ¿Ves a nosotros? Estamos al lado de la puerta.
3. Sara pone su ropa en el armario.
4. Mis padres quieren comprar el sofá hoy.
5. ¿Cómo puedo ayudar a Ud., señor?

Answers

1. Los libros están en mi muchila
2. Nosotros estamos al lado de la puerta
3. Sara puso la rompa en el armario

The way to replace the direct object is to use Los, nos, la, lo, lo.

The direct object is the word that follows the verb and acts as the object of it. In the sentences, the direct objects are:

Los libros (the books)a nosotros (to us)su ropa (her clothes)el sofá (the couch)a ud señor (to you)

In spanish this nouns can be replaced using the words la, lo, las, los and in some cases me, te, nos, se, depending of the situation the number and the gender

Libros = singular, masculine = los = Yo los tengoNosotros = plural, masculine = nos = ¿nos ves?Ropa = singular, feminine = la = Sara la poneSofá = singular, masculine = lo = Mis padres lo quieren comprarSeñor = singular, masculino = lo = ¿Cómo lo puedo ayudar?

Learn more in: https://brainly.com/question/9700436

Conjugate verb to tú affirmative command ¡ [_____] ! (caminar)



can someone help me with this??

Answers

i mean caminar means walk so i think that’s what it is...

Answer:

camina

Explanation:

The affirmative tú command is usually (and in this case yes) just the word conjugated in the el/ella/usted present tense.

Escribe. Write sentences to say what has to or doesn't have to) be done. Use hay que.

Answers

Answer:

2- Hay que organizar la ropa.

3- Hay que limpiar la  habitación.

4- Hay que botar la basura.

Explanation:

1. saber (tú) _supiste___
2. estar (ustedes) ______________
3. dar (nosotros) _______________
4. querer (yo) _________________.
5. poner (vosotros) _________________
6. ser (ellos) ___________________
7. decir (vosotros) _______________
8. Tener (yo) __________________
9. decir (nosotros) _______________
10. tener (usted) __________________
11. ser (nosotros) _________________
12. poner (yo) ____________________
13. poder (ellos) _________________
14. estar (ella) __________________
15. hacer (ella y yo) __________________
16. dar (usted) ____________________
17. Ir (yo) _______________________
18. dar (ellos) ____________________
19. ir (ella) ________________________
20. traer (yo) ______________________

Answers

1 se
2 están
3 damos
4 quiero
5 ponéis
6 son
7 desis (I'm not sure)
8 tengo
9 décimos
10 tiene
11 somos
12 pongo
13 pueden
14 está
15 hacemos
16 da
17 voy
18 dan
19 va
20 traigo

Tú _____ a la profesora que el examen fue difícil (decir, Preterite)

Answers

I think the answer is Dijiste

Answer:

La respuesta es "decir".

Explanation:

decir a la profesora que el examen fue difícil.

Instructions: Your friend is going on vacation to South America. In 5 complete Spanish sentences tell him what transportation not to take. Be sure to mention 4 - 5 different modes of transportation and use negative tu commands.( Will Mark Brainliest)​

Answers

Answer:

No sé mucho sobre viajes, pero digo que no deberías tomar un taxi o un uber porque no ayuda con el tráfico. Los autobuses son la forma más fácil de moverse y también hay pequeños minibuses. Hay vuelos internos hasta Cuidad del Este si prefiere no tomar el bus nocturno allí. Los autobuses internacionales también operan desde Chile, Argentina, Uruguay y Brasil.

[100 POINTS!!!!] https://brainly.com/question/22802006 Complete sections 4, 5, and 6. Make sure you do all the questions! There are two images attached to the link's question, look over them and put what you have in your answer. Any improper or just plain d‎u‎m‎b questions will be reported, so answer wisely!

Answers

Answer:

Explanation:

4  

   1. ¿Qué ropa llevas puesta cuando montas en bicicleta?

       Llevo puesto mi casco, coderas, rodilleras y ropa con colores muy llamativos para que todos me vean.

   2. ¿Qué ropa llevas puesta cuando tienes calor?  

        Llevo ropa muy ligera: una camiseta u pantalones cortos.

    3. ¿Qué ropa llevas puesta cuando practicas deportes?  

        Llevo tenis, una camiseta de algodón para absorber el sudor y pantalones cortos

     4. ¿Qué ropa llevas puesta cuando tienes frío?  

          Llevo una chamarra, pantalones de mezclilla, calcetas de lana y botas para clima frío.

      5. ¿Qué ropa llevas puesta cuando vas a la escuela?  

            Llevo mi uniforme escolar una chamarra por si acaso hace frío o llueve.

       6. ¿Qué ropa llevas puesta cuando vas a un concierto?  

            Llevo puesta una playera alusiva al cantante o grupo que se va a presentar.

5  

Maribel quiere el vestido anaranjado

Tú quieres la blusa blanca

Vosotros queréis la camisa amarilla

Usted quiere las sandalias obscuras

Yo quiero el pantalón de mezclilla azul

Los amigos de Maribel quieren el pantaloncillo verde

Mis amigas y yo queremos los zapatos cafés

Ustedes quieren las medias ralladas de naranja y negro

6  

quiere una chaqueta nueva

piensa

entienden

empieza

prefiero

cierra

Answer:

there

Explanation:

hope it helps

Cuarenta menos doce son_
(a) treinta y ocho
(b) veintiocho
(c) cincuenta y dos
(d) cuarenta y dos​

Answers

Answer:

B. veintiocho es la respuesta

B. Veintiocho
Espero que te sirva

Who controls the security at the Museum of Natural History?
Dr. Sabato
the security guard
the government
the agency

Answers

Answer:

dr sabato

Explanation:

he controls all the security thats how he got the diamond out of the case

Answer:

Dr. Sabato

Explanation:

Edge

pleaseeeee helpppppppppppp

Answers

1- Celebramos
2- tiene
3- decoran
4- luces
5- flores
6- nuestro
7- video
8- sacar
9- rompemos
10- dulces
11- abrir

Hola, abuela:
¿Cómo estás? ¿Te gusta tu nueva (1)
portátil? Voy a explicarte cómo abrir una cuenta de
correo electrónico. Primero, elige un nombre de (2)
y una (3)
de un mínimo de seis caracteres. Para (4)
que tu cuenta funciona adecuadamente, escribe
un mensaje con tu nueva (5)
electrónica. ¡No te olvides de poner el símbolo de
(6)
Si quieres (7)
un archivo, sólo tienes que hacer clic en el
icono del clip. Puedes utilizar tu cuenta en un teléfono (8)
con acceso a la
(9)
El correo electrónico también tiene un corrector (10)

que la (11)
te asusta un poco, pero estoy seguro de que puedes hacerlo. El año pasado
enviaste (12)
de texto sin problema.
Un beso muy fuerte,
Mario

Answers

Answer:

computadorausuariocontraseñasaberfirmaenvíoabririnteligenteredortográficocomputadoraun correo

Explanation:

Other Questions
Which of the following is equivalent to 2(5p 2q)? 10p + 4q 10p 2q 7p + 4q 7p 4q Communism is an extreme form of socialism.TRUE OR FALSE What is the most common theme of haiku? Wwhich file should you edit for sendmail configuration? Does the FCC protect consumers? How does religious conflicts affect society? Match each rhetorical appeal to its correct definition. Match Term Definition Ethos A) An appeal to emotion that may use vivid imagery, descriptions of emotional events, or emotionally charged words Logos B) An appeal to credibility, ethics, or moral principles that may use positive references to the audience's sense of right versus wrong Pathos C) An appeal to logic or reason that may use facts, statistics, and citations of valid evidence to bring an audience to a clear and logical conclusion What was the first Agricultural Revolution known as? What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word?