Answer:Hi I’m sorry I’m not helping I just really need to answer something for points so I can ask a question
Explanation:
It’s due tomorrow and it’s for a grade so im freaking out
A substance only composed of one kind of atom is a(n) *
question one : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other
question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other
question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age
fill in the complementary bases according to the base-pair rule.
a | t | c | c | g | a | t | a | g | c | t | t | a | g
Give two examples each of centripetal force
Answer:
Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.
Explanation:
What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?
Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid
Answer:
Lipid is the most likely answer.
Use the results of Demetri's experiment to explain why the color changed on some test strips but not others.
Answer:
I think it was the same due to all the tubes havign gluscoes in them. I think thats right.
Explanation:
What would be the temperature at a depth of 2500 km?
Answer:
4700 Degrees Celsius
Explanation:
Which name is best for my new bearded dragon?
1. Chili
2. Mushu (dragon from Mulan)
3. Blue (dino from Jurassic Park)
Answer:
Mushu
Explanation:
what is the percentage of thymine in wheat ?
Answer:
27.1% or 27% if rounded
Explanation:
Hope this helps ya!!
(HELP ASAP 15 POINTS)
Is the coloring of the peppered moths an example of competition, differential reproductive success, or inherited variation? Explain why.
Answer:
Peppered moths get their color in lieu to become the fittest among all so that they can survive easily.
Answer/Explanation:
Differential reproductive success.
When the Birch(white) trees were covered in soot(making them black). The black pepper months could blend in to the tree while the white moths stood out.
When the Birch(white) trees were clean and white. The white pepper moths could blend in to the tree while the black moths stood out.
This is an example of differential reproductive success. Who ever could blend in with the tree had the better genes because it made them difficult to be spotted. The other type of moth would be not so lucky, easily spotted an eaten. The better gene lead is "successful," because that moth could live longer because of its characteristics..
WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:
glycogen is to glucose.
testosterone is to a steroid hormone.
a phospholipid is to a plasma membrane.
a nucleotide is to a nucleic acid.
ASAPPPP!!!!
Write step by step instructions for making a protein
4) How does climate affect ecosystems and the life within them?
Answer:
Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.
A h e t e r o z y g o u s parent is crossed with a h o m o z y g o u s recessive parent. Complete a Punnett Square and answer the questions below.
I Am Not Sure What Your Asking?
Answer:
Black Fur & Black Eyes: 4/16
Black Fur & Red Eyes: 4/16
White Fur & Black Eyes: 4/16
White Fur & Red Eyes: 4/16
4 is 1/4 of 16
Explanation:
I hope this helps
Explain how one celled organisms get oxygen in water.
Answer:
n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.
Explanation:
SOMEONE I NEED HELP!! I'M STUCK 30 POINTS!!!!!
PART A
An advantage of mitosis is the result of genetically____________.
A. Different
B.Identical
PART B
cells being reproduced
A. slowly
B. Quickly
Please Help me as soon as possible.
In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.
Answer:
The answer is; c
It is important to distinguish between codominance and incomplete dominance.
In incomplete dominance, the two alleles blend with each other in phenotype giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.
In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.
Explanation:
If researchers use only the number of coral found in dive 1, calculate the predicted population of brain coral in a reef that covers 120m squared. i forgot how to do this :))
Answer:
40
Explanation:
Each quadrant measured = 2m X 2m
Length = (2+2+2) m = 6m
Width = 2m
Total area = area of (quadrant 1 + quadrant 2 + quadrant 3)
Total area = 6 * 2 = 12 m^2
Number of coral found in dive 1 = 4
Population density = 4/12 = 1/3 (0.33)
Now,
=> Population density = (Predicted population)/area
=> 1/3 = PP/120
=> PP = 120/3 = 40
So, the required answer is 40.
The predicted population of brain coral in a reef covering 120m² is ; ≈ 40
First step : Calculate the value of the default population density
Population density = population size (dive 1) / total area
= 4 / 12 = 0.33
Total area ;
∑ Area of each reef quadrant = length * width = 2 * 2 = 4m²
∴ Total area = 4 + 4 + 4 = 12m².
Final step : Determine the value of the predicted population of brain coral
Population density = ( predicted population ) / predicted area
0.33 = ( pp ) / 120m²
∴ Predicted population ( pp ) = 0.33 * 120
= 39.6 ≈ 40 brain corals
Hence we can conclude that the predicted population of brain coral is 40
Learn more : https://brainly.com/question/16495075
Transcription: DNA to mRNA: 1. How many strands of mRNA are transcribed from the two "unzipped" strands of DNA? 2. If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA code onto mRNA? G-G-A-T-C-G-C-C-T-T-A-G-A-A-T-C 3. If DNA Is described as a double helix, how should mRNA be described? 4. How are the accuracy of DNA and mRNA codes assured?
( help please)
Answer:
what are u taking this on
Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?
Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?
Answer:
Wedging (for the first one)
Explanation:
Using the diagram below, how many electrons will Be have if it is a neutral atom?
The law of___________explains how traits are inherited through generations.
Answer:
the law of inheritance
hurry due in five min plz help
Answer:
b
Explanation:
Answer:
d
Explanation:
I hope that helped!
Which of the following is a pluton?
A. Pyroclast
O
B. D*ke (it's a type of rock not the slur)
O
C. Lahar
O
D. Lava flow
Answer:
The correct answer is d*ke
Explanation:
I tried the other answer and got it wrong, this was the right one on the test.
........ produces hormones and enzymes that aid digestion.
Liver
Gall bladder
Pancreas
Urethra
Answer:
urethra
Explanation:
Answer:
Pancreas and liver
Explanation:
If you were to leave a pan of water outside for several days what would happen
Write a scientific report on the what would happen, and how would they relate to the tree states of water: solid, liquid and gas.
At least 3 paragraphs.
Answer:
the water would evaporate and the water would be gone
Explanation:
hope this helps
In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion
Answer:
Facts that is right
Explanation:
In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion
The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.
These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion
Learn more about:
https://brainly.com/question/7135096
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were
Answer:
u want step by step?
Explanation:
Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae
Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.
What are brown algae?Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.
Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.
Learn more about brown algae, here:
https://brainly.com/question/8717436
#SPJ2