Give me a highly detailed explanation of the answer to the equation of 1+1.

Answers

Answer 1

Let's solve this question as simply as we can

Step 1:

Add your odd numbers which is one with one

There are many ways in which we can classify numbers, Such as using the terms odd numbers and even numbers and a example of an odd number is one as it can not be divided by 2.

ex. 1 divided by 2 = 0.5

Step 2:

Now after adding our odd number you should turn up with an even number which we know as two.

Even numbers can be divided by 2

ex. 2 divided by 2 = 1

Answer is = 2


Related Questions

Choose a system of equations with the same solution as the following system:

6x + 2y = −6
3x − 4y = −18

a) 8x + 4y = −4
17x + 2y = −28

b)12x + 4y = 12
21x + 2y = −36

c) 6x + 8y = −36
15x + 6y = −60

d)6x + y = 15
15x − y = −9

Answers

Answer: A. 8x + 4y = -4

                    17x + 2y = -28

Step-by-step explanation:

Sasha spent $7.00 of the $20.00 in her wallet. Which decimal represents the fraction of the $20.00 Sasha spent?

Answers

Answer:

0.7

Step-by-step explanation:

Answer:

0.35

Step-by-step explanation:

When x is 4, y is 12. If y varies directly as x, which equation relates x and y?

Answers

Answer:

12/4

Step-by-step explanation:

y varies directly with x basically means y÷x so you will have to divide the variables together. In other words, it basically means y varies proportionally as x

so in this case, it would be 12 divided by 4 resembling that y varies directly as x

3/8 of the homes have a red door how many homes have a red door​

Answers

Answer:

three out of the eight homes have red doors. so 3 homes have red doors

Step-by-step explanation:

What is 727.526 in word form

Answers

Answer:

I believe that's a decimal point

Step-by-step explanation:

If yes then,

Seven hundred and twenty seven point five two six

Answer:

727.526 in word form is :Seventy-five thousand seven hundred and twenty-six

Step-by-step explanation:

hope this helps :)

Solve the equation 4(2x + 1) = 6x - 12
x=-13/2
x = -8
x = 8
X=11/2

Answers

4(2x+1)=6x-12

4(2x)+4(1)=6x-12

8x+4=6x-12

2x+4=-12

2x=-16

2x/2=-16/2

x=-8

Order the numbers from least to greatest

Answers

Answer:

2 then the square root of 7 then 9.5

Step-by-step explanation:

Answer:

Step-by-step explanation:

√7,2,9.5

√7=2.645

So

Order the numbers from least to greatest is

2,√7,9.5 is the answer

The difference between a number y and 9 is -34. What is the number?

Answers

Answer:

y-9=34

y=34+9

y= 43

Step-by-step explanation:

please Mark as brainliest

Answer:

y= -25 because if you add -25 to 9 it gives you -34

are the triangles congruent if so state how they are congruent.

Answers

Answer:

Step-by-step explanation:

They are congruent.

SSS

A soup recipe makes 6 cups. How many people does it serve if each serving is 3/4 of a cup?
6
10
8
4​

Answers

8
6/.75 =8
I hope this helps!!!

Answer: 8

please see below for work!

Little help here guy

Calculate volume

Answers

Answer/Step-by-step explanation:

Problem 1:

Radius = 4.8 cm

Height = 6 cm

Volume of cylinder (V) = πr²h

Plug in the values

V = π*4.8²*6 = 434.29 cm³

Problem 2:

Length of pipe = 26 cm

Internal diameter = 6.5 cm

Thickness = 0.5 cm

Pipe volume (V) = π(R² - r²)h

where,

R = Outer radius = ½(6.5) + 0.5 = 3.75 cm

r = inner radius = ½(6.5) = 3.25 cm

h = height = 26 cm

Plug in the values

V = π(3.75² - 3.25²)*26 = 285.88 cm³

Problem 3:

Volume the cylindrical paint can hold = 2.5 litres = 2.5*1000 = 2,500 cm³

Height (h) = 16 cm

Radius (r) = ??

Volume of cylindrical can (V) = πr²h

Plug in the values

2,500 = π × r² × 16

2,500 = 16π × r²

Divide both sides by 16π

2500/16π = r²

49.7 = r²

Take the square root of both sides

√49.7 = r

r = 7.05 cm (nearest hundredth)

Problem 4:

The section of the guttering is ½ of a cylinder

Diameter = 14 cm = 0.14 m

Radius = ½(0.14) = 0.07 m

Volume = 20 litres = 0.02 m³

Length (h) = ??

Volume of the guttering = ½(volume of cylinder) = ½(πr²h)

Plug in the values

0.02 = ½(π*0.07²*h)

0.02*2 = 0.0049π*h

0.04 = 0.0049π*h

Divide both sides by 0.0049π

0.04/0.0049π = h

2.6 = h (nearest tenth)

Length = 2.6 m

Problem 5:

Height of the smaller cylinder (h) = 13 cm

Radius of the smaller cylinder (r) = ½(7) = 3.5 cm

Volume of smaller cylinder = πr²h = π × 3.5² × 13 = 500.3 cm³

Volume of larger cylinder filled to a height of 5 cm = Volume of smaller cylinder

Thus:

Volume of cylinder filled to height of 5cm = 500.3 cm³

height (h) = 5

radius (r) = ???

Therefore,

500.3 = π × r² × 5

500.3 = 5π × r²

500.3/5π = r²

31.9 = r²

√31.9 = r

r = 5.6 cm (nearest tenth)

Leanne runs on the treadmill and rides the exercise bike at the gym to stay in shape. She burns 15 calories per minute on the treadmill and 9 calories per minute on the bike. She wants to ride the bike 2.5 times as long as she runs on the treadmill and burn a total of 580 calories. The system of equations below can be used to find the number of minutes, t, she should run on the treadmill and the number of minutes, b, she should ride the bike.


According to this system of equations, can Leanne meet both her goals?

A.
Yes, she can run on the treadmill for 15 minutes 28 seconds.

B.
No, she cannot ride the exercise bike a negative number of minutes.

C.
Yes, she can ride the exercise bike for 15 minutes 28 seconds.

D.
No, she cannot run on the treadmill for a fractional number of minutes.

Answers

Answer: C

Step-by-step explanation:

step 1: I

step 2: just

step 3: took

step 4: it

final answer: i took the test and got a 100 so its definitely C.

<3

In this picture B and F are
midpoints.
x=[ ? ]

Answers

Answer: x = 10

see in the picture, ΔACE has:

+) BF//AE

+) B and F are  midpoints.

=> BF is the median line of the triangle ACE

=> BF = 1/2. AE

=> AE = 2BF

⇔ 5x - 4 = 2.23 = 46

⇔ 5x = 46 + 4 = 50

⇔ x = 50/5 = 10

Step-by-step explanation:

15+9/2 leave your answer in fraction​

Answers

15 can be 15/1 = 30/2
30/2 + 9/2 = 39/2

Which number has a value between -8.423 and -8.395?

A. -8.1
B. -8.75
C. - 8 1/2
D. 8 2/5

Answers

Answer:

Step-by-step explanation:

Jmeu eimejrimr

The number between -8.423 and -8.395 will be - 8 2/5.

What is Fraction?

A fraction is a part of whole number, and a way to split up a number into equal parts.

Given that;

Two numbers are,

⇒ - 8.423 and - 8.395

Now,

Since, Two numbers are,

⇒ - 8.423 and - 8.395

Clearly, - 8.1 is greater than - 8.423 and - 8.395.

Hence, It is not between the numbers - 8.423 and - 8.395.

Clearly, - 8.75 is less than - 8.423 and - 8.395.

Hence, It is not between the numbers - 8.423 and - 8.395.

Clearly, - 8 1/2 is less than - 8.423 and - 8.395.

Hence, It is not between the numbers  - 8.423 and - 8.395.

Clearly, - 8 2/5 = - 8.4 is in between - 8.423 and - 8.395.

Hence, It is between the numbers  - 8.423 and - 8.395.

Thus, The number between -8.423 and -8.395 will be - 8 2/5.

Learn more about the fraction visit:

https://brainly.com/question/28897348

#SPJ6


Find the slope using the formula.
(-2, -9) and (-6, -6)

Answers

m = y1 - y2 / x1 - x2
m= -9 + 6 / -2 + 6
m= -3 / 4

Probability please answer‍♀️ Helppp please

find the expectation e(x) and variance var(x) for the task
suppose you choose a real number x from the interval [2, 10] with a density function of the form f(x) = c/x , where c is a constant

Answers

Step-by-step explanation:

Let X be a random variable with PDF given by

fX(x)={ cx2 |x|≤1 0 otherwise

Find the constant c.

Find EX and Var(X).

Find P(X≥

1

2

).

Point A is at (3, - 8) and point B is at (7, 3)

What is the midpoint of line segment overline AB ?

Please help

Answers

I think it’s (4,-5) but I’m not sure

If f(x)=8x+16, then find f-1 (x)

Answers

if u mean f(-1)= 8x+16, then the answers is 8

at 4 pm charlie realizes he has half an hour to get to his grandmother's house for dinner? if his grandmother lives 40 miles away, how fast will charlie have to drive to get there on time?

Answers

Answer:

10 minutes

Step-by-step explanation:

Speed = distance ÷ time, so 40 ÷ 4 = 10

hope this helps :)

during a sale, an appliance that costs $275.00 is being sold at a discount for $220.00. which equation can be used to find the size of discount, d during the sale?​

Answers

Answer:

20% discount

Step-by-step explanation:

275 - 220 = 55

55/275 = 0.2

The discount is 20%

Answer:

20% discount

Step-by-step explanation:

275 - 220 = 55

55/275 = 0.2

0.2(100)=20

There is a 20% discount.

Estimate the area of the inregular shape. Explain your method and show your work.
Please help 100 points and brainliest

Answers

Estimation : 27.5 square units

From the above coordinates: a = 7 length units, b = 4 length units and h = 5 length units. Therefore, approximate area = [(7+ 4)/2]*5 = 27.5 square units.

Hope it helps.

can u pls help me with this question ​

Answers

The correct answer is a

Part D
You now have an equation to model the finances of the car wash. What is the value of the profit when the baseball team washes 0 cars? What point represents the value? What does the y-value of this point mean in terms of the problem?​

Answers

Answer:

The equation for the profit made on the car wash is y = 5x – 75. Here, y is the profit made and x is the number of cars washed. So if the team washes 0 cars, x will be 0.

y = 5(0) – 75

y = -75

The point that represents this is (0, -75). Here, the value of the y-coordinate of the point is -75. Since it has a negative sign, it means that instead of making a profit, the team suffers a loss. So, if the baseball team washed no cars, it would lose $75.

Step-by-step explanation:

The recently released iPhone XS Max comes in three different storage sizes: 64GB, 256GB, and 512GB. The price of the 64GB phone is $1,099. If prices were proportional to the phone's storage size, how much would the 256GB phone and the 512GB phone cost
Any help please

Answers

Answer:

iPhone XS Max: $1,249/256GB,

$1,449/512GB

Step-by-step explanation:

Got it !!!

Find the probability of guessing correctly at least 6 of the 10 answers on a true-false examination.

Answers

Answer:

24%

i think

Step-by-step explanation:

TRUE OR FALSE:
If 2x−5 = 13, then x=4

Answers

Answer:

False

Step-by-step explanation:

Add 5 to isolate varible to get 2x=18. Dived by 2 to get x=9.

Which steps can be done to both sides of the equation to determine the value of x? 3.2 x - 9.6= 38.4

Answers

Answer:

add both sides ny 9.6 and divide both sides by 3.2, hope this helps!

Convert: 7 pt 1 c = [] c​

Answers

Answer:

Pint value is 1 and cup value is 1 pt = 2 c. Sorry if I am wrong!

Step-by-step explanation:

What is the most logical explanation for why kilo is a more important prefix to remember than ""tera"" (the metric prefix for 1 trillion)?

Answers

Quantities of thousands are more common than quantities of trillions. hope this helps!

We want to compare two prefixes, kilo and tera, and see why one seems to be more important than the other.

The prefix "kilo" is used for thousands, while the prefix "tera" is used for trillions.

Now if you go to your day-to-day life, you will see that the thousands appear a lot more than the trillions.

For example, is more common to walk one or two kilometers than one terameter.

Or also is more common to buy a kilogram of potatoes than one teragram of potatoes.

This is mainly why kilo is more important (actually is more used, I wouldn't say that is more important) than tera.

If you want to learn more you can read:

https://brainly.com/question/5470764

Other Questions
compare endocytosis and exocytosis. ( one similarity and one difference) what chapter was it when christfer colubus saild the alantic sea Which ordered pair is a solution of the equation -4x + 7 = 2y - 3 which set of the numbers is equivalent to 75%? (0.75 3/5), (7.5 75/100), (3/4 0.075), (15/20 0.75) Identify the independent variable (domain). 5x+2y= 150 I WILL GIVE A LOT OF EXTRA POINTS. PLEASE ANSWER ALL OF THEM The manufacturers of can of salted mixed nuts state that the ratio of peanuts to other nuts is 6 to 5 . If 414 peanuts are in a can how many other nuts should also be in the can (8,9), X + 8y = 9Help me please What is 15% of 140? A.2,100 B.30 C.21 D.119 What was a vassal required to pay to their lord? crops money land tares Helppp ASAP. Emma wants to enlarge a square photo and print it to a square canvas. The sidelength of the canvas is 12 in. The scale from the canvas to the photo is 4 in. to 1 in.What is the side length of Emma's photo? Show your work. What other story element is most affected by the narrator's point of view?A) the story's titleB) the story's settingC) the story's theme Express the recurring decimal 0.56 (Just the 6 is recurring) in its simplest form. What should you ask yourself before you post a photo, video, or other information about another person online? 1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD