help with this question

Help With This Question

Answers

Answer 1
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

Related Questions

Yule logs are commercially available that burn with a red and green flame. What two chemicals could produce this effect?

Answers

Answer:

Strontium chloride: Makes a red flame.

Strontium sulfate: Makes a green flame.

Copper salts (such as copper sulfate or copper chloride) and barium salts (such as barium chloride or barium nitrate) can produce a red and green flame when burned.

The colors of flames are often determined by the presence of specific chemicals or elements that emit characteristic wavelengths of light when heated. In the case of red and green flames, copper and barium salts are commonly used.

Copper salts, particularly copper sulfate or copper chloride, can produce a green flame when burned. This is due to the emission of specific wavelengths of green light by excited copper ions in the flame.

Barium salts, such as barium chloride or barium nitrate, can produce a red flame when burned. The red color is caused by the emission of specific wavelengths of red light by excited barium ions in the flame.

When these two chemicals are combined in a yule log or firework formulation, they can create a visually appealing display of red and green flames. The copper and barium ions are heated and excited by the flame, releasing their characteristic colors of light. It is important to note that the production of colored flames should be done with caution and adherence to safety guidelines to ensure proper handling and disposal of chemicals.

To learn more about chemicals, here

https://brainly.com/question/29240183

#SPJ2

A long thin sample of a substance is easily bent. When the substance is placed in a n electric circuit and the switch is closed, and LED light turns on. What type of bonding holds the particles of the substance together?

Answers

Answer:

A metallic bonding holds the particles of the substance together

Explanation:

The unknown substance is a metal:

It is easily bent: This means it is ductile, as it is the case with a thin metallic metallic wire."When the substance is placed in a n electric circuit and the switch is closed, and LED light turns on." This means it easily conducts electricity. Metals are good conductors.

20 POINTS!!
Kinetic and Potential Energy

Answers

A ball sitting on the peak of a mountain (potential) then the ball rolling down (kinetic)

Answer:

When a ball is rolled up a hill, it has potential energy that can turned into kinetic energy. The kinetic energy would be the ball rolling down the hill.

Explanation:

Hope this helps!

Write the name for the compound Al₂S₃

Answers

Answer:

Uh Joe stinky?

Explanation:

Answer:

Aluminum(2)sulfur(3)

Explanation:

PLEASE I NEED THIS ANSWER ASAP :(
Impurities that evaporate easily and travel with the water vapor are not removed when using this type of distillation. Explain the reason for this.

Answers

Answer:

Please add as brainlist

Explanation:

Distillation is the process of separating the components or substances from a liquid mixture by using selective boiling and condensation. Distillation may result in essentially complete separation (nearly pure components), or it may be a partial separation that increases the concentration of selected components in the mixture. In either case, the process exploits differences in the relative volatility of the mixture's components. In industrial applications, distillation is a unit operation of practically universal importance, but it is a physical separation process, not a chemical reaction.

Scientists claim that climate change is happening because Earth is warming. They also claim that humans have helped cause the warming by adding greenhouse gases to the atmosphere. Other people claim that Earth is not experiencing climate change because some winter days are still very cold. Use evidence to evaluate each claim about climate change.

Answers

We know it’s C because of what it says in the text

Credit: https://climate.nasa.gov/causes/

The industrial activities that our modern civilization depends upon have raised atmospheric carbon dioxide levels from 280 parts per million to about 417 parts per million in the last 151 years. The panel also concluded there's a better than 95 percent probability that human-produced greenhouse gases such as carbon dioxide, methane and nitrous oxide have caused much of the observed increase in Earth's temperatures over the past 50-plus years.

The panel's full Summary for Policymakers report is online at https://www.ipcc.ch/site/assets/uploads/2018/02/ipcc_wg3_ar5_summary-for-policymakers.pdf.

cholrine is an active non-metal.why? ​

Answers

Chlorine has 7 electrons in its outer shell. It only needs one electron to fill up that shell. It can attract that electron better than all the other elements in period 3, because it has more protons. It is very reactive and hence a very active non-metal.

Many ladybird beetles live in Pedro's garden. He observed them one summer for a science project. Pedro noticed that all the ladybird beetles had red shells. Some of the beetles had many dark spots, some had only a few dark spots, and one or two beetles had no dark spots at all. Around the same time, Pedro's father replanted the garden using just red flowers. A few years later, Pedro observed the ladybird beetles again. This time he noticed that almost all the ladybird beetles had shells with more red visible. They had few or no dark spots on their shells. Pedro concluded that replanting the garden with red flowers caused a change in the ladybird beetle population. Which best explains Pedro's observations?

Answers

Answer:

No.

Explanation:

No, Pedro's observations does not suggest that replanting the garden with red flowers caused a change in the ladybird beetle population because the colour of flower has no effect on the change in the population of ladybird beetle, it must be occur due to the dominant genes present in the population of ladybird beetle. This dominant genes is responsible for the presence of more red colour on the ladybird beetles shells.

Consider the following reaction: 3Fe(s) + 4H₂O(g) ➞ Fe₃O₄(s) + 4H₂(g). To answer the following question: "How many moles of hot water vapor (steam) must react to produce 275 g of Fe₃O₄?" How many steps will it take to get the answer? *
4 points
1
2
3
4

Answers

Answer: 2

Explanation:

To calculate the moles :

[tex]\text{Moles of solute}=\frac{\text{given mass}}{\text{Molar Mass}}[/tex]

[tex]\text{Moles of} Fe_3O_4=\frac{275g}{233.5g/mol}=1.18moles[/tex]

[tex]3Fe(s)+4H_2O(g)\rightarrow Fe_3O_4(s)+4H_2(g)[/tex]  

According to stoichiometry :

1 mole of [tex]Fe_3O_4[/tex] are produced by = 4 moles of [tex]H_2O[/tex]

Thus 1.18 moles of [tex]Fe_3O_4[/tex] will be produced by=[tex]\frac{4}{1}\times 1.18=4.72moles[/tex]  of [tex]H_2O[/tex]

Mass of [tex]H_2O=moles\times {\text {Molar mass}}=4.72moles\times 18g/mol=85.0g[/tex]

Thus 85.0  g of [tex]H_2O[/tex] will be required and 2 steps are required to get the answer.

Using the Assignment: Locating the Epicenter, What was the length of the radius of the circle of from the Buenos Aires station? (in cm)
Question 1 options:


3.2 cm


4.8 cm


5.76 cm


8 cm

Answers

It may be 4.8cm? Tell me if i’m wrong or right. I’m so sorry if it’s wrong.

How many atoms of each element are in the chemical formula Ca(OH)2? ​

Answers

1 calcium, 2 oxygen, and 2 hydrogen. :)
Calcium hydroxide, Ca(OH) 2 consists of one calcium atom (A r = 40), two oxygen atoms (A r = 16) and two hydrogen atoms (A r = 1).

2H20--12H2 + O2
How many moles of H2 are produced when 2.54 moles of H2O reacted?

Answers

Answer:

2.54mole of H₂

Explanation:

The reaction expression is given as:

           2H₂O  →   2H₂  +   O₂

Given;

Number of moles of H₂O  = 2.54moles

Unknown:

Number of moles of H₂ produced  = ?

Solution:

To solve this problem, we use the concept of mole comparison. Now from the reaction expression, we know that;

                  2 mole of H₂O will produce 2 mole of H₂

                 2.54 mole of H₂O will then produce 2.54mole of H₂

Advantages and disadvantages of solar power

Answers

Answer:

Advantakes= it is a renewable source, you can but it anywhere with sunlight

disatvantage= it cost a lot to place/replace, it uses a lot of different materials

Hobbies options what is a better particle most similar to
Electron
The positive laser
Nucleus
Gamma ray

Answers

Answer:

Gamma ray

Hope this helps!!!!!!!!

Develop a relationship (in the form of a single sentence or equation) that can predict the charge based on the number and types of particle.

Answers

Answer:

The charge of an atom is determined by the ratio of protons to electrons

Explanation:

I hope this helps!!

A relationship showing the charge on an atom can be expressed as  ;

Types of particle are protons and electrons Charge on atom = ( Number of protons - Number of electrons )

The charge an atom posses depends on the particles/components of the atom which are protons and electrons. The protons are positively charged ions that are present in the nucleus of an atom while electrons are negatively charge ions present in the outer shell of an atom.  

To predict the charge on an atom we will determine the difference between the  number of protons and the number of electrons present in an atom.

Hence we can conclude that the relationship can be expressed as Types of particle are protons and electrons , Charge on atom = ( Number of protons - Number of electrons )

Learn more : https://brainly.com/question/5686932

Which is a component of John Dalton’s atomic theory?
The ratio of atoms in a compound is fixed.
The atoms of different elements are the same.
An atom is a small particle of matter that can be broken down.
A reaction can create or destroy atoms as well as rearrange them.

Answers

Answer: lol the answer is A

Explanation:

i’m just smart like that , thought i should give y’all a clue

Answer:

The ratio of atoms in a compound is fixed.

Explanation:

its a

Balance the following equations:
i. N2 + …..H2 → ….. NH3
ii. P4 + …….O2 → ….P2O5
iii. ……NaF + Br2 →…….NaBr + F2
iv. …..ZnS + …..O2 → …..ZnO + …..SO2
v. Pb(NO3)2 + …..NaCl → ……NaNO3 + PbCl2​

Answers

Hey There!_____________________________________Answer:_____________________________________

(I) [tex]N_{2} + 3H_{2} --> 2NH_{3}[/tex]

(II) [tex]P_{4} + 5O_{2} --> 2P_{2} O_{5}[/tex]

(III) [tex]2NaF + Br_{2} -->2NaBr + F_{2}[/tex]

(IV) [tex]2ZnS + 3O_{2} --> 2ZnO + 2SO_2[/tex]

(V) [tex]Pb(NO_3)_2 + 2NaCl --> 2NaNO_3 + PbCl_2[/tex]

_____________________________________Best Regards,'Borz'

name the ionic compound NH4NO3

Answers

Ammonium nitrate
Ammonium = NH4+
Nitrate = NO3-

After food is consumed, chemical nutrients are absorbed into the blood. The blood then carries these nutrients to the body's cells where the nutrients enter mitochondria. Which reaction must occur next for the cell to carry on other activities?

Answers

Answer:C

Explanation:oxygen,light,and glucose combine to produce high energy molecules

Answer:

c

Explanation:

I got this answer right so trust me

Y’all wanna help me? For Brainiest

Answers

O= 6
Al= 3
Rb= 1
Kr= 8

Someone please Help please When you are measuring your pulse (heart beats per minute) what system are you monitoring?
A. Digestive
B. Respiratory
C. Circulatory
D. Integumentary (skin)

Answers

B. Respiratory
Because your check the rate of your breathing by checking the pulse

Someone please help will mark as brainliest

Answers

Answer:

PET works by using a scanning device (a machine with a large hole at its center) to detect photons (subatomic particles) emitted by a radionuclide in the organ or tissue being examined.

Newer technology combines PET and CT into one scanner, known as PET/CT. PET/CT shows particular promise in the diagnosis and treatment of lung cancer, evaluating epilepsy, Alzheimer's disease and coronary artery disease.

Explanation: Most Brainliest Please

If a metal donates or loses an electron it becomes a..
A. Ionic
B. Covalent
C. Metallic

Answers

Answer:

c

Explanation:

Answer:

the answer to your question is c

A boundary between air masses that don't move possibly causing rain for several days.

Answers

Answer:

A Front

Explanation:

A Front is a boundary between two air masses of different density, moisture, or temperature

true or false, water boils at 100°c

Answers

Answer:

This is true

Explanation:

True or false
Equal forces acting on one object in opposite directions are called balanced forces

Answers

Answer:

True

Explanation:

Forces, equal in magnitude and opposite in direction, and cancel each other out are called Balanced Forces.

Balanced Forces DO NOT cause any change in the velocity of the object, but the Object may correspond to a change in shape or size.

Example :

Blasting a balloon by compressing it tightly with both hands, roughly with an equal force, is a practical example of Balanced Forces. In this case, the balloon before the burst stays at a state of rest and same after the burst. But the burst or the compression, causes a change in the shape of the balloon.

a + c = r solve for a

Answers

Answer: A = -c + r

Explanation:

Answer:

a = r-c. its that simple I guess

what happen when the nitrate of an alkali metal is heatad?

Answers

answer

Gives brown colour gas

Most nitrates tend to decompose on heating to give the metal oxide, brown fumes of nitrogen dioxide, and oxygen.

Whar is the innermost par of the bone called

Answers

Answer:

If it's what I think you're talking about, it's called marrow.

Explanation:

Hope this helped! :)

The innermost part of the bone is called bone marrow

Which factor can cause acceleration to decrease?

Answers

The acceleration of an object depends directly upon the net force acting upon the object, and inversely upon the mass of the object. As the force acting upon an object is increased, the acceleration of the object is increased. As the mass of an object is increased, the acceleration of the object is decreased.
Other Questions
Describe the following influences on our food choices and provide an example of each one.Your cultural backgroundProduct packagingProduct pricing I have another question: If triangle GFE~ to triangle ABC, Find FG. Pioneers began to specialize in specific types of work. To specialize means to Which sentence goes with which images? sorry i forgot images lol 1. Tengo las tijeras.2. El teclado es grande.3. Tienes la pega.4. El ratn es pequeo. HURRY IM BEING TIMED AND ILL AWARD BRAINLIST PLSSSS HURRY Will mark Brainlist! You created a Gingerbread house out of the same dough. Each side of the house is a 4 x 6 rectangle. How much Gingerbread dough would you need to create the entire house including the floor? Hint: find the surface area. From a graph, how do you identify the solution of a system of equations? 50 POINTS!!!! Write about the Manifest Destiny, Then, choose three aspects of the painting "American Progress" (by John Gast) that depict Manifest Destiny and explain your reasoning. The side of a cube is increasing at a rate of 2 kilometers per hour. At a certain instant, the side is 1.5. What is the rate of change of the volume of the cube at that instant (in cubic kilometers per hour)? Which option best describes MacHack 6?A. It was a text-based adventure game.B. It was a graphical adventure game.C. It was a shooter game.D. It was an interactive chess program.E. It was a puzzle game t At contract maturity the value of a call option is ___________, where X equals the option's strike price and ST is the stock price at contract expiration. a. max (0, ST - X) b. min (0, ST - X) c. max (0, X - ST) d. min (0, X - ST) Gabriela has dinner at a cafe and the cost of her meal is \$45.00$45.00dollar sign, 45, point, 00. Because of the service, she wants to leave a 15\%15%15, percent tip.What is her total bill including tip? forgot to put photo but this is a repost HELP EMEBAHNDJFKG Heather rode her bike at a rate of 15 feet per second. Which graph best represents the relationship between the time in seconds Heather rode her bike, x, and the distance in feet she rode, y? A particle executes simple harmonic motion with an amplitude of 2.00 cm. At what positions does its speed equal one fourth of its maximum speed? find a counter example for the following statement all triangles have one 90 degree angle proportional constant what type of weather forecasting can forecast from 3-7 days? I NEED ANSWERS FAST!!! PLEASE HELP ITS TIMEDWater and mountons form barriers that can limit the movement of organism's true or false