If 1.85 grams of Mg(OH)2 reacts with 3.71 grams of HCl how much MgCl2 is produced?what is the limiting reactant? 1Mg(OH)2+2HCl=1MgCl2+2H2O

Answers

Answer 1

Answer

Mg(OH)2 is the limiting reactant

Mass of MgCl2 produced = 3.02 g

Explanation

Given: The balanced chemical equation

mass of Mg(OH)2 = 1.85 g

mass of HCl = 3.71

Solution

Mg(OH)2

[tex]1.85g\text{ Mg\lparen OH\rparen}_2\text{ x }\frac{1\text{ mol Mg\lparen OH\rparen}_2}{58,3197g}\text{ x }\frac{1\text{ MgCl}_2}{1\text{ Mg\lparen OH\rparen}_2}\text{ = 0.031 mol MgCl}_2[/tex]

HCl

[tex]3.71g\text{ HCl x }\frac{1\text{ mol HCl}}{36,458g}\text{ x }\frac{1\text{ MgCl}_2}{2\text{ HCl}}\text{ = 0.051 mol MgCl}_2[/tex]

Therefore Mg(OH)2 is the limiting reactant.

Calculation of MgCl2 mass

[tex]0.031\text{ mol MgCl}_2\text{ x }\frac{95,211g}{1\text{ mol MgCl}_2}\text{ = 3.02 g}[/tex]


Related Questions

why do you like homo and heterogen mixtures?

Answers

Homogeneous are hard to seperate but heterogeneous are easy to seperate.

What role does heterogeneous mixture have in daily life?

Every day, humans employ heterogeneous mixes that can be found all around them. Particles in heterogeneous mixtures can be recognized after mixing and still maintain their chemical characteristics. Filtration and chemical processes can be used to separate the components of heterogeneous mixes.

All substances exist in one state of matter, which is a homogenous mixture. Solids can combine uniformly with other solids, liquids can combine with other liquids, and so on.

On the other hand, a heterogeneous mixture (derived from the Greek word "hetero" for dissimilar) has a non-uniform composition, which means that different parts may contain more or less of a given component. A heterogeneous mixture allows for the simultaneous existence of solid, liquid, and gas phases as well as other states of matter.

To learn more about

heterogeneous mixture refer

https://brainly.com/question/24898889?

#SPJ13

Why are race cars and bicycles made of lightweight materials?

Answers

For less traction…..

Copper(II) oxide can be reduced by hydrogen:
CuO(s) + H2(g) → Cu(s) +H2O(g)
What mass of copper can be obtained from 15.9 g of copper(II) oxide?

Answers

Answer:

do that in calc

Explanation:

mass of cu = 63.55 ÷ 79.55 × 15.9

a hydrogen atom emits a photon. you are given the wavelength of the photon. what sign will the energy of the photon be calculated as?

Answers

The energy of the photon to will be calculated by using E=hv.

Photons are fundamental subatomic particles that carry electromagnetic force — or, to put it another way, they are light particles. The energy of a photon is calculated by determining the wavelength of the photon. To do this, we need to know the frequency of the light and its speed in a vacuum.

A hydrogen atom emits a photon with a frequency of about 6.6x1014 Hz and a speed in a vacuum of 3.0x108 m/s.

The value for E = hν is:

E = hν

= Planck's Constant × Frequency × Wavelength

= hc/(2π×frequency × wavelength)

The unit of energy is given by Joules(J).

To learn more about photon visit: https://brainly.com/question/20912241

#SPJ4

In a parallel circuit with identical light bulbs, which of these is true?
A
A battery is not the source of voltage.

B
There is only one resistor, such as a light bulb.

C
The circuit is left open so that current cannot flow.

D
Adding more identical light bulbs will not change their brightness.

Answers

In a parallel circuit with identical light bulbs, the true statement is option D Adding more identical light bulbs will not change their brightness.

Two bulbs in a simple parallel circuit every experience the overall voltage of the battery. that is why the bulbs in the parallel circuit might be brighter than the ones within the series circuit. some other gain to the parallel circuit is that if one loop is disconnected, then the other stays powered.

While batteries are connected in parallel, the voltage remains the same, but the contemporary which could float in the circuit will increase. when bulbs have equal power, then their resistance is likewise the same. while the 2d bulb connected in parallel to the first bulb is switched on, the effective resistance of the circuit turns into half of, and the present-day circuit becomes double. due to it, this double modern-day divides itself equally into bulbs.

The voltage across every resistor inside a parallel aggregate is precisely equal however the currents flowing through them are not the same as that is determined by their resistance fee and Ohms regulation.

Learn more about parallel circuits here:-https://brainly.com/question/80537

#SPJ1

If [H+] = 1.0 x 10-11 M, what is the pH of the solution?

Answers

Answer:

use the pH equation :

pH: -log [H+]

pH: -log 1×10^-11

pH: 11.00

the pH of the solution is 11.00 and the solution is basic.

and make sure to remember :pH does not have a value .

a solution merely has pH(11.00)

If a substance conducts electricity when dissolved in water, turns litmus from blue to red, and tastes sour, would you expect it to be acidic, basic, or neutral? Justify your answer.

Answers

Answer:

The substance is acidic.

Explanation:

When a substance is able to dissolve in water, it means that it is ionic. This just means that the polarity of the water and the polarity of the substance will attract each other to their positive and negative ends respectively. (Positive attracts negative and negative attracts positive).

Litmus paper that is blue and then turns red when introduced to a substance, is known to be acidic.

The opposite can be said when red litmus paper turns blue when introduced to a substance; this means the substance is basic.

Also, if it is sour, then that means it is acidic! Some examples of sour things that are acidic are soft drinks, apples and lemons/limes.

What is the volume of 2.00 moles of an unknown gas at STP?
O2.00 L
0 11.2L
0 44.8L
O 22.4L

Answers

should all countries provide free universal healthcare to all its citizens? Why or why not? Explain.provide a film review that explains your opinion about the documentary

When sodium hydroxide reacts with sulfuric acid a solution of sodium sulfate is produced.
a.) Describe how crystals of sodium sulfate can be obtained from a solution of sodium sulfate.

Answers

When an acid and a base react, the base balances the acid, creating salt and water as a result..

2NaoH+ H2SO4----> Na2SO4 + H2O

Both sulfuric acid H2SO4 and sodium hydroxide NaOH are powerful acids and bases, respectively.

This reaction is exothermic in nature and is referred to as the neutralizing reaction (since heat is released during the reaction as there is formation of new bonds).

a). If you left your aqueous sodium sulfite solution open on the side, air oxygen would catalyze the chemical shift, the water would hydrate the new compound, and the slow evaporation of water would give you wonderful huge crystals of Na2SO4 without you having to do anything.

To know more about neutralizing reaction visit:-

https://brainly.com/question/20038776

#SPJ13

A student measures 25ml of acid into the flask and adds the 3 drops of the indicator. if the student then adds 20ml of water to the flask, will this change to amount of base needed to reach the endpoint?

Answers

The addition of water to the acid solution will change the molarity of the solution, but not the amount of base needed to reach the titration endpoint because the total amount of acid hasn't changed.

During this titration, a solution of the base will be added to a solution of the acid, and when the endpoint is reached, the indicator will change color. The titration endpoint is reached when the acid in the sample solution has been completely neutralized, and an excess base is now appearing.

The amount of base required for neutralization is determined by the amount (number of moles) of acid in the starting solution. Although the starting solution would become more dilute (lowering its molarity) upon the addition of water, the total amount of acid will not be reduced, thus requiring the same amount of base.

You can learn more about molarity here:
brainly.com/question/16727614

#SPJ4

the reaction 2a → a2​​​​​ was experimentally determined to be second order with a rate constant, k, equal to 0.0265 m–1min–1. if the initial concentration of a was 3.75 m, what was the concentration of a (in m) after 180.0 min?

Answers

Based on the integrated equation used for reactant concentration calculation in a second-order reaction and the data given (initial concentration, reaction rate constant, and time elapsed), the concentration of A after 180.0 min will be 0.20 M.

The integrated equation for the reactant concentration in a second-order reaction looks like this:

1/[A] = kt + 1/[A]₀

k - reaction rate constant (0.0265 min⁻¹M⁻¹)

[A]₀ - initial concentration (3.75 M)

t - time elapsed (180.0 min)

1/[A] = 0.0265 min⁻¹M⁻¹ * 180.0 min + 1/(3.75 M) = 4.77 M⁻¹ + 0.27 M⁻¹ = 5.04 M⁻¹

[A] = 1 / (5.04 M⁻¹) = 0.20 M

You can learn more about second-order reactions here:
brainly.com/question/12446045

#SPJ4

How does using the ocean as an energy resource interact in both positive and negative ways within each of Earth's spheres?

Answers

The ocean using as an energy resource interact in both positive and negative ways within each of Earth's crust as the ocean produces two types of energy, these are thermal energy from the heat of sun, and mechanical energy from the tides and waves.

For example, when ships transport oil, the waste water is occasionally dumped. It means that ships may release some amount of pollution into the ocean and air. Some of the heat which is stored in the ocean could power the entire planet.

These ocean energy sources, both thermal energy and mechanical energy are non-polluting, dependable, and highly predictable. Oceans covers more than 70% of the surface of Earth. It makes them the greatest solar collectors on the planet.

To learn more about energy,

brainly.com/question/3022807

#SPJ1

cheggin the experiment to determine which mechanism was used by restriction endonucleases, what evidence ruled out the formation of a covalent intermediate?

Answers

The covalent phosphodiester bonds of DNA are hydrolyzed by restriction enzymes, leaving either "sticky/cohesive" ends or "blunt" ends.

By incubating the target DNA molecule with restriction enzymes, which detect and bind certain DNA sequences and cleave at specified nucleotides either inside or outside of the recognition sequence, restriction digestion is carried out.

An isolated bacterial protein known as a restriction enzyme cleaves DNA at sequence-specific locations to create DNA fragments with a known sequence at either end. Restrictions enzymes are crucial for numerous laboratory processes, including recombinant DNA technology and genetic engineering.

At the particular restriction site, DNA bonds between the 3′ OH of one nucleotide and the 5′ phosphate of the following one are cleaved by restriction enzymes.

In order to prevent the plasmid vector from ligating with itself and to verify that the inserted gene is oriented correctly, two separate restriction enzyme sites might be used.

A) #1 5′ - CGTGATCTCGATTCGCTAGTAACGTT - 3′

         3′ - GCACTAGAGCTAAGCGATCATTGCAA - 5′

    #2 5′ - TCATGAATTCCTGGAATCAGCAAATGCA - 3′

         3′ - AGTACTTAAGGACCTTAGTCGTTTACGT - 5′

B) Recognition sites:

#1 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

#2 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

C) Cleavage sites:

#1 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

#2 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

The correct and complete question is in the image.

Learn more about Restriction enzymes here:

https://brainly.com/question/13944056

#SPJ4

Here is my question on Electron Configurations. There are 5 parts: a to e.

Answers

Answer:

too lendi to answer the question

how to identify oxides that don't dissolve in water?

Answers

Answer: The oxides of hard metal or the transition metals oxides like oxides of copper, zinc, iron, and chromium do not dissolve in water due to their limited basicity. Alkaline earth metal oxides also form hydroxides in water but these hydroxides themselves give slaked solutions and are not completely soluble.

Explanation: The oxides of hard metal or the transition metals oxides like oxides of copper, zinc, iron, and chromium do not dissolve in water due to their limited basicity. Alkaline earth metal oxides also form hydroxides in water but these hydroxides themselves give slaked solutions and are not completely soluble.

you have two test tubes. one test tube contains fe 3(aq) solution and the other test tube contains ni 2(aq). predict what will happen when naoh(aq) is added to both test tubes. if a reaction occurs, what is the new chemical formula?

Answers

The new chemical formula is [tex] Fe(OH)_{3}[/tex] or ferric hydroxide.

Ion [tex] {Fe}^{3 + } [/tex] will react with NaOH while [tex] {Ni}^{2 + } [/tex] will not. The chemical reaction is as follows -

Chemical reaction stating reaction between [tex] {Fe}^{3 + } [/tex] and NaOH.

[tex] {Fe}^{3 + } [/tex] + NaOH → [tex] Fe(OH)_{3}[/tex] + Na

In the reaction, [tex] {Fe}^{3 + } [/tex] represents ferric ions, NaOH is the chemical formula of sodium hydroxide, [tex] Fe(OH)_{3}[/tex] is the chemical formula of ferric hydroxide and Na represents sodium. The ferric hydroxide precipitates as reddish brown. It does not dissolve in excess is sodium hydroxide.

Chemical reaction stating reaction between [tex] {Ni}^{2 + } [/tex] and NaOH

Nickel does not react with sodium hydroxide due to its basic nature. The reason can be owed to electron donating characteristic of both the metal and base.

Learn more about metal and sodium hydroxide reaction -

https://brainly.com/question/25597694

#SPJ4

Look at the two waves shown. What is the speed of each wave?

Answers

The speed of all electromagnetic waves is equal to the speed of light that is 3 × 10⁸ m/s.

What is an electromagnetic wave?

An electromagnetic wave is a wave of certain wavelength of an electromagnetic radiation of the electromagnetic spectrum. There are different types of waves in the spectrum like IR, radio waves etc.

The speed of c of the wave is the product of its frequency and wavelength. The speed of all electromagnetic waves are equal to the speed of visible light.

Hence, the speed of both waves is 3 × 10⁸ m/s.

To learn more about the electromagnetic waves, refer the link below:

https://brainly.com/question/3101711

#SPJ1

What mass of HCI is needed to
generate 45.2 g of AICI3?
2AI + 6HCI → 2AlCl3 + 3H₂
AICI3: 133.33 g/mol
HCI: 36.46 g/mol

Answers

Answer:

37.1g of HCl

Explanation:

rate as brainliest

2. Explain the significance of the discovery of gallium (mass number 68) to Mendeleev periodic table

Answers

The significance of gallium is explained below

Describe gallium.

The atomic number and symbol for the chemical element gallium are 31. The discovery was discovered in 1875 by French chemist Ga. Paul-Émile Lecoq de Boisbaudran. Gallium is a similar metal to the other elements in Group 13 of the Periodic Table (aluminium, indium, and thallium).

Under normal pressure and temperature, gallium is a soft and silvery element. When it's liquid, it takes on an icy white hue. Using too much force could cause gallium to shatter conchoidally. Since its discovery in 1875, gallium has been frequently used to produce alloys with low melting points. It is also used in semiconductors as a dopant on semiconductor substrates.

In 1875, a French chemist by the name of Paul Emile Francois Lecoq de Boisbaudran made a spectroscopic discovery of a new element while studying zinc blende. The properties of this freshly discovered element matched those of the eka-aluminum, which has an atomic weight of 69, as predicted by Mendeleev. The specific gravity of the element was later determined to be 5.9, as predicted by Mendeleev. The substance was then given the name gallium by Lepoq, who so elevated Mendeleev's periodic table and supported Mendeleev's theories.

To know more about gallium, click on the link

https://brainly.com/question/13398355

SPJ10

Match the structural formulas given to you below with the correct chemical formula from the bank above. (Image provided)

Answers

1) C3H6O because there are 6 hydrogen in formula and one oxygen. 2) H2So4 sulphric acid.  

What three categories exist for chemical formulas?

Chemical formulas can be divided into three categories: empirical, molecular, and structural. Molecular formulas display the quantity of each type of atom in a molecule, while structural formulas display the simplest whole-number relationship between the atoms in a compound. Empirical formulas display the simplest whole-number relationship between the atoms in a compound.

3) C2H2 ethyne where carbons have triple bond.

4) CO carbon monoxide where C and O have triple bond between them  .

5) HNO3 is nitric acid .

6) CH2F2

7) Ch2O

8) C2H4 is ethene in which carbon carbon have double bonds.

9) SO3 sulphur trioxide.

10) CH3F

To learn more about chemical formula refer

https://brainly.com/question/11995171?

#SPJ4

Describe these three experiments which have been used to support the atomic theory: Cathode Ray Tube, Gold Foil Experiment, and Atomic Emission Spectra.

Answers

The atomic theory developed along the experiments of the  Cathode Ray Tube, Gold Foil and Atomic Emission Spectra.

What is the atomic theory?

The term atomic theory has to do with the arrangement of the particles that compose the atom. Let us look at the development of the atomic theory chronologically.

Cathode Ray Tube - In the cathode ray tube, J.J Thompson was able to pass  an electric discharge through the tube and a color was observed that corresponds to the gas in the tube.

Gold foil experiment - Here, thin gold foils were bombarded with alpha particles and the movement of the alpha particles were tracked.

Atomic emission spectra - Here, electrons were excited to different wavelengths and the corresponding spectra was observed.

Learn kore about atomic theory:https://brainly.com/question/28853813

#SPJ1

Write the electron configuration (1s², 2s²,...) for the following:
Hydrogen
2
Fluorine
Boron - 1s²2s²2p¹
3 Aluminum
Draw the electron configuration with the correct atomic orbitals for the following:
4 Sodium
6
5 Sulfur
Boron-
Argon
15². 25
2p

Answers

that is for hydrogen, fluorine and aluminium

Which of the following samples can be considered as a concentrated
solution of Povidone Iodine, an antiseptic for minor wounds ?

A. 3 drops of Povidone Iodine dissolved in 100 ml of water.

B. 5 drops of Povidone Iodine dissolved in 100 ml of water.

C. 10 drops of Povidone Iodine dissolved in 100 ml of water.

D. 50 drops of Povidone Iodine dissolved in 100 ml of water.

Answers

The sample that should be considered concentrated solution of Povidone Iodine is 50 drops of Povidone Iodine dissolved in 100 ml of water. That is option D

What is a concentrated solution?

A concentrated solution is defined as the type of solution that contains more dissolved solute with less solvent when compared with other solutions.

A solute is defined as the part of a solution that dissolves in a solvent while the solvent is part of the solution that is the dissolving medium.

From the options listed, the most concentrated solution is the solution that contains more of the povidone iodine which is 50 drops of Povidone Iodine dissolved in 100 ml of water.

Learn more about solvent here:

https://brainly.com/question/26429686

#SPJ1

What is the speed of a car that travels 45 miles in 45 minutes? Answer in miles per hour.

Answers

Answer:60 miles in one hour

Explanation:

What is the lithosphere? ) (25 pts)

Answers

The rigid outer part of the earth, consisting of the crust and upper mantle.

1. using your titration data, calculate the %na2co3 for each trial, the average %na2co3 and standard deviation. 2. describe how to obtain a second derivative plot. 3. why is potentiometry used to detect the endpoints for this titration? could color indicators have been used?

Answers

Simply subtract the differences in the first derivative values from the differences in the midpoint volumes to obtain the second derivative, and then plot this value at the intersection of the two midpoint volumes.

Potentiometric titration is a laboratory method to determine the concentration of a given analyte.

Na2CO3 and NaHCO3 concentration in a mixture can be determined by accurately weighing 2.0 g of the mixture and making a distilled water solution in a 250 ml standard flask. Use phenolphthalein as an indicator while you gradually titrate 25 ml of this solution against regular hydrochloric acid. To concord, repeat (Vp ml).

In order to locate the equivalency more precisely, a second derivative plot is also generated. point—where the extrapolated line intersects the x-axis (graph 4). A highly precise value for the volume of titrant can be acquired because the x-axis indicates the volume of titrant utilized.

Potentiometric titration is one of the chemical methods of analysis, and it involves adding a titrant with a known concentration and measuring the endpoint of the titration with an indicator electrode that records the change in potential as a function of the amount (often the volume) added.

To learn more about Potentiometric titration visit:https://brainly.com/question/28855227

#SPJ4

What scientific principle do bulletproof vests worn by law enforcement officers best illustrate when they protect personnel from impact injury in the line of duty?

Answers

Answer:

Ballistic vests use layers of very strong fibers to "catch" and deform a bullet, mushrooming it into a dish shape, and spreading its force over a larger portion of the vest fiber. The vest absorbs the energy from the deforming bullet, bringing it to a stop before it can completely penetrate the textile matrix.

A river flows at a rate of 57.3m/sec, what is the rate when it is converted to km/day? Please answer fast!!!

Answers

4950.72 hope this helps

Help, how to solve? - The question underneath, why is it Option C (4.8*10^23 ions) and not option B (1.2*10^23 ions). How do we solve and approach the question?

Answers

Option C (4.8 × 10²³ ions) is correct not option B (1.2 × 10²³ ions) as one molecule of (NH₄)₃PO₄ contains four ions, three NH₄⁺, and one PO₄⁻³.

To calculate ions, first, we have to calculate number of molecules of (NH₄)₃PO₄ in 0.20 moles.

To calculate number of molecules, the number is moles is multiplied by Avogadro number (6 × 10²³).

So, the number of molecules of (NH₄)₃PO₄ in 0.20 moles is,

Number of molecules = 0.20 × 6 ×10²³ = 1.2 × 10²³

One molecule of (NH₄)₃PO₄ contains three ions of NH₄⁺, and one ion of PO₄⁻³. So, number of ions in 0.20 moles of (NH₄)₃PO₄ are

Number of ions = 4 × 1.2 × 10²³ =4.8 × 10²³

Learn about the difference between number of molecules and atoms at:

https://brainly.com/question/12515630

#SPJ1

This long unit of measurement can be used to measure great distances. It *
is equal to 1000 meters.
Omillimeter
O centimeter
O meter
O kilometer
Odecimeter

Answers

Kilometer.

Kilo=1,000
Other Questions
A projectile is thrown at an angle 30 from horizontal. Which statement about its vertical component of velocity is true? Nicholas earned $2,000.00 working over the summer and wants to put the money into a savings account. A savings account at bank A earns 5% simple interest and a savings account at bank B earns 4% interest compounded quarterly. If Nicholas plans to deposit the $2,000.00 and leave it in the account for 4 years, at which bank would he earn more interest? A. The interest earned cannot be calculated from the given information. B. The interest earned at both banks will be the same. C. bank A D. bank B In the the diagram to the right, sphere O with radius 5 cm is intersected by a plane 4 cm from center O. Find the radiusof the cross section O A read and be familiar with marbury v. madison. how did the supreme court establish itself and the overall purpose of the court as a result of this case. Question 5 (05.05)Based on the graph, what is the initial value of the linear relationship? what is 3 +(-4) on a number line Solve for U.-3 + 2u + 6 = -8u - 7What does U equal? HELP ASAP I NEED ANSWER NOWW IT'S MISSING PLEASE HELP 50 POINTS if luna adds 1/2 cups of flour to a mixing bowl for a recipe 5 times, how much flour has she added? Please help ASAPQuestion is attached below I need to know how to rewrite the expression using the distributive property of multiplication over addition Consider the 636 N weight held by two cables shown below. The left-hand cable had tension T and makes an angle of with the wall. The right-hand cable had tension 890 N and makes an angle of 26 with the ceiling.What is the angle which the left-hand cable makes with respect to the wall? DIVIDE THE POLYNOMIALS USING LONG METHOD. QUESTION 1 Divide (x4 + 2x - 13x - 38x - 24) + (x + 4) 3. Identify the function of the verbal: After you finish this book, you will want everyone toread it.A. SubjectB. Subject ComplementC. Direct ObjectD. Object of PrepositionE. Adjective Nina bought 1.725 pounds of pecans and 1.83pounds of almonds. She also bought twice as manypounds of walnuts as pecans. How many morepounds of walnuts did she buy than almonds? Discuss some of the ways in which analytics assist information systems management as well as the organization at large. What kinds of data are most useful and how is it gathered? How do managers protect customers, clients, and even employees personally identifiable information in order for those who may not have permission to view it? How is the data secured in general? If g :R R is given by g(x) = x2 + 3 , find the function f such that (g. f) (x) = 4x2 + 3. A. 3x B. 4x C. 2x D. None of these forward contract. the wolfpack corporation is a u.s. exporter that invoices its exports to the united kingdom in british pounds. if it expects that the pound will appreciate against the dollar in the future, should it hedge its exports with a forward contract? explain. In what way did the plaques affect the leader of Spanish explorers that traveled through north and Central America LOUIS Quest-ce que tu 1 of 6 (aimer) faire le week-end, Nadia? NADIA Le samedi matin, je 2 of 6 (retrouver) mes copains au parc pour faire du vlo. midi, ma famille et moi, nous 3 of 6 (manger) au restaurant dhabitude. Laprs-midi, mon frre et moi, on 4 of 6 (jouer) au foot. Le soir, mes grands-parents nous 5 of 6 (inviter) souvent au cinma. Et ta famille et toi, quest-ce que vous faites le week-end? Est-ce que vous 6 of 6 (voyager) avec des amis ou de la famille?