Please help it would mean alot!
Points and brinliast!

Please Help It Would Mean Alot! Points And Brinliast!

Answers

Answer 1

Answer:

Maybe because what about the other votes that were supposed to be left.

Step-by-step explanation:


Related Questions

Read the passage below and summarise it in a minimum of 100 words:

Until a hundred years ago as humans, we had a simple, uncomplicated biological connect. It was a straightforward equation: we drew roughly 3,000 calories each of energy out of the Earth for our food and life’s sustenance. Today that number per capita has grown to 100,000 calories. We still need only 3,000 calories each to nourish life itself. All the rest of this energy is what we extract from the Earth for everything else besides keeping ourselves alive. In some countries, like the US; this per capita number runs at over 200,000 calories! Some of us are concerned about this.

We fret over what we could and should really be doing to soften this abuse of resources. Little things fox us in the welter of things that we get to read. What is sustainable development? How can it be started in our homes? Beyond the ceremonial planting of green arid getting people to run marathons of various lengths in support of the environment, is there- more that we can add to the abstract value of “sustainability”? What are the little things we can do in our day-to-day lives, to reduce demand for things that people make and market? Of course, we know that it helps to avoid a plastic bag when you can use a newspaper bag, or a brown bag, or even a jute bag which you can use for many more years, unlike a plastic bag which you throw away in less than a week or after a few uses.

However, there’s actually quite a bit more than you and I can do without compromise on comfort, with very little as cost incurred, with financial savings that you can gain on energy and water use, and with solutions that are very feasible and within your reach. It is possible to understand our ecological footprint and its disastrous consequences, not merely in terms of our own behaviour as consumers, but really in terms of the impact on the environment we make.

(Source: Building Green and Thinking Green, 2010)​

Answers

Answer:

Find the summary below.

Step-by-step explanation:

The article compares the standard of healthy living some hundred years ago to what is obtainable in our world today. While the energy gained through food consumption some years ago was just adequate and at the right proportion, what is consumed today, supplies energy that is on an all-time high. This misuse of resources led to the development of sustainable development practices such as planting of trees, exercise routines which are done occasionally.

Another sustainable practice that can be done on a more regular basis is the use of jute or paper bags which are more biodegradable, instead of plastic bags. Finally, the article encourages the adoption of more sustainable practices because they can be more economical compared to the other practices that are presumed to be the status quo.

The linear equation when b= 5 and m = -2 is O y = 5x – 2. Oy= 5x + 2. y = -2x - 5. O y = -2x + 5​

Answers

Answer:

y = -2x + 5

General Formulas and Concepts:

Algebra I

Slope-Intercept Form: y = mx + b

m - slope b - y-intercept

Step-by-step explanation:

Step 1: Define given

y-intercept b = 5

Slope m = -2

Step 2: Write function

y = -2x + 5

4. Verify that the functions fand g are inverses of each other by showing that
f(g(x)) = x and g(f(x)) = x.

F(x)=2x-3/x+4
g(x) = 3+4x/2-x

Answers

Answer and step-by-step explanation:

We just have to apply one function in the other one. See:

→ f(g(x)):

[tex]f(x) = \dfrac{2x-3}{x+4}\\\\f(g(x)) = \dfrac{2g(x)-3}{g(x)+4} = \dfrac{2\cdot\dfrac{3+4x}{2-x}-3}{\dfrac{3+4x}{2-x}+4}\\\\f(g(x)) = \dfrac{\dfrac{6+8x}{2-x}-3}{\dfrac{3+4x}{2-x}+4}\\\\f(g(x)) = \dfrac{\dfrac{(6+8x)-3(2-x)}{2-x}}{\,\,\,\dfrac{(3+4x)+4(2-x)}{2-x}\,\,\,}=\dfrac{(6+8x)-3(2-x)}{(3+4x)+4(2-x)}\\\\f(g(x)) =\dfrac{6+8x-6+3x}{3+4x+8-4x}=\dfrac{11x}{11}\\\\\\\boxed{f(g(x)) = x}[/tex]

→ g(f(x)):

[tex]g(x) = \dfrac{3+4x}{2-x}\\\\g(f(x)) = \dfrac{3+4f(x)}{2-f(x)} = \dfrac{3+4\dfrac{2x-3}{x+4}}{2-\dfrac{2x-3}{x+4}}\\\\g(f(x)) = \dfrac{3+\dfrac{8x-12}{x+4}}{2-\dfrac{2x-3}{x+4}}\\\\g(f(x)) = \dfrac{\dfrac{3(x+4)+(8x-12)}{x+4}}{\,\,\,\dfrac{2(x+4)-(2x-3)}{x+4}\,\,\,}=\dfrac{3(x+4)+(8x-12)}{2(x+4)-(2x-3)}\\\\g(f(x)) =\dfrac{3x+12+8x-12}{2x+8-2x+3}=\dfrac{11x}{11}\\\\\\\boxed{g(f(x)) = x}[/tex]

What verifies that f and g are inverses of each other.

Q.E.D.

a pump can fill 2400 litres an hour and its replacement model can fill 2.5% more, how man litters an hour can the new model fill​

Answers

Answer:

2,460 liters per hour

Step-by-Step Explanation:

The problem above requires only two operations: multiplication and addition. First, you have to answer this question: How much is 2.5% of 2,400 liters?"

You may do this by multiplying 2,400 by 2.5%.

2,400 x 2.5% (0.025) = 60 liters (this is the amount that the new model can fill more than old model).

Then, you have to add 60 liters to 2,400 liters.

2,400 liters + 60 liters = 2,460 liters

This means that the new model can fill 2,460 liters per hour.

The probability of a person being left-handed is about 11%. Suppose you interview 500 people. About how many people would you expect to be left-handed? Group te?

Answers

Answer:

78

Step-by-step explanation:

Hi

There is  5 *100  people  and  so  11 every 100 is  left handed so  within 500 people  there is  5*11 people  left handed  =  55

you can also do  500 * 11/100 = 55

the first six multiples of 6

Answers

6, 12, 18, 24, 30, 36

select all the equations on which the point (10, 0) lies. A. 5x+2y=15 B. 2x+4y=20 C. x+6y=10 D. 3x+3y=13 E. 4x+2y=20 F. 6x+y=50

Answers

Answer:

The answer to this problem is B, C, and E.

Step-by-step explanation:

The true equations are B. 2x+4y=20 and C. x+6y=10

How to determine the equations?

The point is given as (10,0)

This means that:

x = 10 and y = 0

Next, we test the options by substituting the above values.

So, we have:

A. 5x+2y = 15

5(10) + 2(0) = 15

50 = 15 ---- false

B. 2x+4y = 20

2(10) + 4(0) = 20

20 = 20 ---- true

C. x+6y=10

10 + 6(0) = 10

10 = 10 ---- true

D. 3x+3y=13

3(10) + 3(0) = 13

30 = 13 ---- false

E. 4x+2y=20

4(10) + 2(0) = 20

40 = 20 ---- false

F. 6x+y=50

6(10) + 0 = 50

60 = 50 ---- false

Hence, the true equations are B. 2x+4y=20 and C. x+6y=10

Read more about linear equations at:

https://brainly.com/question/14323743

#SPJ9

Find the area of the parallelogram.

Answers

Answer:

Step-by-step explanation:

Area of parallelogram = base * height

                                    = 3 * 3

                                    = 9 square units

Help Please I really need help!

Answers

400+60x

because the flat rate will stay the same, depending on how many hours or labor is how much more money you will pay. 60 dollars per hour of labor

A school district wants to find out why dropout rates were lower at some schools rather than others. What statistical approach would be most appropriate?A) A regression with dropout rates as the independent variableB) A regression with dropout rates as the dependent variableC) A hypothesis test with a null hypothesis that the dropout rate is more than the highest dropout rateD) A confidence interval with the expected dropout rate as the meanE) A hypothesis test with a null hypothesis that the dropout rate is less than or equal to the highest dropout rate

Answers

Answer:

E) A hypothesis test with a null hypothesis that the dropout rate is less than or equal to the highest dropout rate

Step-by-step explanation:

The hypothesis test is the type of test that helped a scientist to determine the relationship between two variables-one constant independent variable and an dependent variable. For the dropout rates in the different schools, it would be better to use the hypothesis test for the evaluation.

What Is 55 > -7x + 6 ?

Answers

Answer:

x>−7

Step-by-step explanation:

55−6>−7x

49>−7x

​7

​49

​​ <x

−7<x

x>−7

Write the standard form of the line that has a slope of −3/4 and y-intercept of −2. Include your work in your final answer.

Answers

First let’s write it in slope intercept form
Y=Mx+b —-> Y=-3/4x-2

Then we can put it in standard form
Ax+By=C

We move the x to the other side
3/4x+y=-2

And that’ll be your answer :)

*if Ax it’s not positive you will have to multiply by -1*

The triangles below are congruent and their corresponding parts are marked

Answers

∠A ≅ ∠Z

you can determine this by seeing that both angles have two curved lines, therefor showing they have the same measurement.

∠B ≅ ∠Y

you can also determine this by seeing that they both have one curved line showing that they share the same measurement.

∠C ≅ ∠X

once again, you can determine this by seeing that both angles are marked with three curved lines, meaning they share the same measurements.

line AB ≅ line ZY

just like before, you can determine that they are equivalent to each other by seeing that both lines have three dashes showing that they have the same measurement.

line AC ≅ line ZX

you can determine these lines are equivalent because they both have one dash showing they are the same length as each other.

line BC ≅ line YX

once again, both lines have two dashes, showing that they are equivalent in length.

ΔCAB ≅ XZY

you can determine this by seeing that all three angles and all three sides on both triangles share measurements with the other triangle

if a coin is flipped 3 times, how likely are you to get tails 3 times in a row​

Answers

Answer:

Suppose you have a fair coin: this means it has a 50% chance of landing heads up and a 50% chance of landing tails up. Suppose you flip it three times and these flips are independent. What is the probability that it lands heads up, then tails up, then heads up? So the answer is 1/8, or 12.5%.

Step-by-step explanation:

Please I need help and I give brainliest thank you!!

Answers

Answer:

i believe it is x=4

Step-by-step explanation:

10x+7=12x-1

7=12x−1−10x

8=2x

divide

x=4

find QR. 18+x + 2x+23=17

Answers

Step-by-step explanation:

1.) x+2x=17-18-23

2)3x=-24

3)x=. -8

hellpppppp due today will give brainliest ​

Answers

Answer:

The last option. <3

-a^2b^2c^2(a+b-c) find the product

Answers

Answer:

-a^3b^2c^2-a^2b^3c^2+a^2b^2c^3

I hope it will be useful.

If the circumference of the circle is 24 inches what is the
approximate diameter

Answers

Answer:

7.64 in.

Step-by-step explanation:

The diameter of the circle whose circumference is 24 inches is 7.654 inches.

What is a circle?

A circle is a two-dimensional object made up of points that are spaced out from a given point (center) on the plane by a fixed or constant distance (radius).

Given:

The circumference of the circle, C = 24 inches,

Calculate the radius of the circle as shown below,

Circumference = [tex]2\pi r[/tex]

C = 2 × π r

r = 24 / 2π

r = 3.819

r = 3.82 inches

Calculate the diameter as shown below,

Diameter = 2 × r

Diameter = 2 × 3.82

Diameter = 7.639 inches

Thus, the diameter is 7.64 inches.

To know more about circle:

https://brainly.com/question/266951

#SPJ2

the number in unit form is all mixed up convert it tostandard form

Answers

Answer:

Step-by-step explanation:

What number?

QUESTION 4 of 10: Market researchers often report discretionary income. Discretionary income is your disposable income minus your fixed
expenses. Your disposable income is $2,920. After you pay fixed expenses of rent, utilities, groceries, and a car payment, you have $900.
What percentage of your disposable income is discretionary?
a) 18%
b) 31%
c) 45%
d) 69%

Answers

Answer:31

Step-by-step explanation:

Answer:

b) 31 %

Step-by-step explanation:

Write each parabola in the form y−k=a(x−h)^2 and determine its vertex: y=−4x^2+16x−19

Answers

X = -b/2a
-16/2(-4) = 2
Substitute 2 into the equation
Y = -4(2)^2 + 16(2) - 19
Y = -16 + 32 - 19 = -3
Vertex = (2, -3)
Vertex form y+3=-4(x-2)^2

if you had to express a typical NBA player's salary with a single number (round to the nearest 100000) you would use

Answers

Answer:

wat

Step-by-step explanation:

What is the relationship between the values of the given digits 7's in 7'700

Answers

Step-by-step explanation:

The given number is 7700.

We need to find the relationship between the values of the digit 7s in it.

The digit in the extreme left is 7 and second no is again 7.

The place value of first 7 is 7000

The place value of second 7 is 700.

Taking ratio of place value of 7 in first 7 and for second 7 as follows :

[tex]R=\dfrac{7000}{700}\\\\R=10[/tex]

So, value of first 7 is 10 times that of the value of second 7.

The area of a square is 81 m ^ 2 what is the perimeter of the square? How do you know?

Answers

Answer:

The answer is 36m.

Step-by-step explanation:

So, first of all, you need to remember that the formula for the area of a square is x^2, or one side multiplied by another side. Also recall that in a square all sides are equal. This means that x^2=81. Now, the square root of 81 equals 9 (you should have this memorized by now). So, if each side of the square is 9, and  there are 4 sides, the perimeter would be 9*4, which is 36m.

Let u = 2i + 3j, v=-i, and w = 5i – 6j. What is the magnitude of 2(u - V + w)?

•10.0
•13.4
•17.1
•21.6

Answers

Answer:

B. 17.1

Step-by-step explanation:

Edge 2020. Hope this helps.

The magnitude of 2(u-v +w) is √292.

The given vectors are u = 2i + 3j, v=-i, and w = 5i – 6j.

We need to find the value of 2(u-v+w).

How to find the magnitude of vector?

The formula to determine the magnitude of a vector (in two-dimensional space) v = (x, y) is: |v| =√(x²+ y²). This formula is derived from the Pythagorean theorem.

Now, 2(2i + 3j-(-i)+5i-6j)

=2(2i+3j+i+5i-6j)

=2(8i-3j)=16i-6j

The magnitude of 16i-6j=√16²+6²=√256+36=√292

Therefore, the magnitude of 2(u-v +w) is √292.

To learn more about the magnitude of vectors visit:

https://brainly.com/question/24256726.

#SPJ2

Need help will mark Brainliest

Answers

I believe it is x=55. I could be wrong lol

Assuming the triangle adds up to 180°, x = 55 because 55 + 5 = 60. 60 x 3 = 180

Find the slope using the formula.
(4, 19) and (2, 11)

Answers

Answer:

[tex]m=4[/tex]

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Algebra I

Slope Formula: [tex]m=\frac{y_2-y_1}{x_2-x_1}[/tex]

Step-by-step explanation:

Step 1: Define

(4, 19)

(2, 11)

Step 2: Find slope m

Substitute:                    [tex]m=\frac{11-19}{2-4}[/tex]Subtract:                       [tex]m=\frac{-8}{-2}[/tex]Divide:                          [tex]m=4[/tex]

what is the approximate area of the shaded sector in the circle shown below?

Answers

Answer:

The sector given in the figure is a semi-circle because the degree measure of the chord is 180 degrees.

Area of semicircle = 0.5π[tex]r^{2}[/tex] = 0.5π×4.5 = 6.75 sq. inches

Find the equation of the tangent line to y=sinx at x=2pie

Answers

Answer:

y = x - 2π

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Algebra I

Point-Slope Form: y - y₁ = m(x - x₁)  

x₁ - x coordinate y₁ - y coordinate m - slope

Pre-Calculus

Unit Circle

Calculus

The definition of a derivative is the slope of the tangent line.

Derivatives of Trig Functions

sin(x) = cos(x)cos(x) = -sin(x)tan(x) = sec²(x)sec(x) = sec(x)tan(x)csc(x) = -csc(x)cot(x)cot(x) = -csc²(x)

Step-by-step explanation:

Step 1: Define

y = sinx

x = 2π

Step 2: Find Derivative

Take derivative:                   y' = cosx

This is the function of the tangent line for y.

Step 3: Find slope

Substitute in x into y':                    y'(2π) = cos2πEvaluate:                                        y'(2π) = 1

This tells us that the slope of the tangent line is 1 at x = 2π.

Step 4: Write equation

Find a point.

Substitute x into y:                     y(2π) = sin2πEvaluate:                                    y(2π) = 0Write coordinate:                      (2π, 0)

Write tangent function.

Substitute:                    y - 0 = 1(x - 2π)Simplify:                        y = x - 2π

This is the equation of the tangent line at x = 2π.

Other Questions
Which graph below correctly shows the two lines on the same axes ? Find the length of side b in the right triangle below. Round to the nearest tenth if necessary A. 8B. 16 C. 32 D. 64 Which thesis is stronger? Explain your answer using complete sentences.A) Globalization has created many new jobs in India. B) Globalization has had a positive effect on India because it offers new solutions to poverty. What is your best memory? In the story behind Barz vets with PTSD basin new Warzone with little support how did David Carlson time at war change him A scientist walking through a forest recorded as integers the heights of 5 trees standing in a row. She observed that each tree was either twice as tall or half as tall as the one to its right. Unfortunately some of her data was lost when rain fell on her notebook. Her notes are shown below, with blanks indicating the missing numbers. Based on her observations, the scientist was able to reconstruct the lost data. What was the average height of the trees, in meters? why did washington did not want political parties??why did jefferson did want political parties?? Which ion has smaller size and why?Mg++ or Na+. Which statement about Monsoons in South Asia is true?Question 1 options:They are seasonal winds that bring rain. They occur all year. Another term for them in Hurricane. They only occur in India Explain why the slope of the line drawn in part C must be negative. what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were