please help me do it

Please Help Me Do It

Answers

Answer 1
4x+1=5x-5
6=x
This is because you subtract 4x from 5x and get 1x and add the -5 to the other side

Related Questions

a technology company makes more than 5 printer every hour. Which graph represent the number of printers made in 4 hours?

Answers

Answer:

See the attached file

Step-by-step explanation:

Given data

Say numbers of printer made per hour = 5 printers

Hence in 1 hour, they will make 5 printers

in 4 hours they will make

=4*5

=20 printers

The graph of this situation when plotted will give a straight line graph

Kindly find attached a straight line graph for your reference


Using Matlab, include the code, a brief discussion of the
code/logic, graphs and screenshots with results, and a brief
analysis/discussion of the results.
4. Repeat exercise 3 using the Secant method. Repeat iterations until the approximate error becomes less than 0.1%. (20%] a. Which method is better? Secant or False-position?

Answers

The correct answer is The logic behind the Secant method is to iteratively update two initial guesses, x0 and x1, based on the function evaluations at those points. The formula x2 = x1 - (f(x1) * (x1 - x0)) / (f(x1) - f(x0)) is used to update the guesses and obtain a new approximation, x2

Here's an example MATLAB code that implements the Secant method to find the root of a function:

% Function to find the root of

function y = myFunction(x)

[tex]y = x^3 - 5*x^2 + 6*x - 2;[/tex]

end

% Secant method

x0 = 0; % Initial guess x0

x1 = 1; % Initial guess x1

approx_error = 1; % Initial approximation error

while approx_error > 0.001 % Set the desired approximation error threshold

[tex]x2 = x1 - (myFunction(x1) * (x1 - x0)) / (myFunction(x1) - myFunction(x0));[/tex]

[tex]approx_error = abs((x2 - x1) / x2) * 100; % Calculate the approximation[/tex]error

   x0 = x1;

   x1 = x2;

The logic behind the Secant method is to iteratively update two initial guesses, x0 and x1, based on the function evaluations at those points. The formula x2 = x1 - (f(x1) * (x1 - x0)) / (f(x1) - f(x0)) is used to update the guesses and obtain a new approximation, x2. The iteration continues until the approximation error, calculated as the absolute difference between x2 and x1 divided by x2, falls below the desired threshold (in this case, 0.001).

To compare the Secant method with the False-position method, you can apply both methods to the same function and compare their convergence and accuracy. You can also analyze the number of iterations required for each method to achieve a certain level of approximation error.

Please note that in order to generate graphs and screenshots with results, it would be best to run the code in a MATLAB environment and visualize the results directly.

Learn more about statistics here:

https://brainly.com/question/29765147

#SPJ11

Complete the equation of the line through (-8,-2) and (-4,6)
Use exact numbers.
y=

Answers

Answer:

round 55666777 for 5th 50th is not a big game for a player who will give the 8th or 3rd season to 466

Help help pretty please

Answers

Answer:

Yes it is

Step-by-step explanation:

It passes the vertical line test.

A=1/2h(b+b)


a
77 ft sq.
b
29 ft sq
c
154 ft sq
d
392 ft sq.

Answers

Answer:

c

Step-by-step explanation:

Answer:

Step-by-step explanation:

Putting values in the equation

A = 1/2(7)(8 + 14)

= 1/2(7)(22)

= 1/2(154)

= 77 ft. sq

Option A is the correct answer

Today i will walk 3 miles per hour to school, which is 1.5 miles away how many hours would this trip take

Answers

Answer: 30 minutes so 1/2 hour

Step-by-step explanation:

Because 3 miles = 1 hour

1.5 times 2 = 3

divide 2 on both sides

Answer:

2 hours

Step-by-step explanation:

divide3 by 1.5 and that is how long it will take you


Let f be a continuous function on R. Suppose f(x) > 0 for all
x and (f(x))2 = 2f for all x ≥ 0. Show that f(x) =
x for all x ≥ 0.
5. Let f be a continuous function on R. Suppose f(x) > 0 for all x and (f(x))2 = 2 5c" f for all x > 0. Show that f(x) = x for all x > 0. . -

Answers

Given that f is a continuous function on R, f(x) > 0 for all x, and [tex]f(x)^{2}[/tex] = 2f for all x ≥ 0, we need to show that f(x) = x for all x ≥ 0.

Let's assume that there exists a value a ≥ 0 for which f(a) ≠ a. Since f(x) is continuous, the Intermediate Value Theorem can be applied. Consider the function g(x) = f(x) - x. Since g(a) ≠ 0, either g(a) > 0 or g(a) < 0.

If g(a) > 0, it implies that f(a) - a > 0, which leads to f(a) > a. But this contradicts the given condition that f(x) > 0 for all x. Hence, g(a) cannot be greater than 0.

Similarly, if g(a) < 0, it implies that f(a) - a < 0, which leads to f(a) < a. Again, this contradicts the given condition that f(x) > 0 for all x. Therefore, g(a) cannot be less than 0.

Since g(a) cannot be greater than 0 or less than 0, the only possibility is that g(a) = 0, which implies f(a) = a. This holds true for all a ≥ 0. Hence, we can conclude that f(x) = x for all x ≥ 0.

Therefore, based on the given conditions, we have shown that f(x) = x for all x ≥ 0.

Learn more about function here:

brainly.com/question/30721594

#SPJ11

A dump truck brought 1⁄3 of a ton of rock on the first trip, 1⁄2 of a ton on the second trip, but on the third trip, had to take back 4⁄5 of a ton. What was the total weight of the rock left at the construction site?

Answers

1/3 + 1/2 + 4/5

The least common multiple of 3, 2, and 5 is 30

1/3 * 10/10 = 10/30
1/2 * 15/15 = 15/30
4/5 * 6/6 = 24/30

10/30 + 15/30 + 24/30 equals
49/30 tons or 1 and 19/30 tons

Answer:

1/30 ton of rock left

Step-by-step explanation:

1/3+ 1/2= 5/6

5/6 - 4/5= 1/30 ton of rock left at the construction site.

6th grade math help me pleaseeee

Answers

Answer:

Meryann brought 6 friends to the party

Step-by-step explanation:

y=9x+24

24 is your constant because the cost for all the pizza won't change

9x will change, so x represents the number of friends she brought

and y will be 78 because it's the total amount of money

78=9x+24

all you have to do is solve this equation

54=9x

x=6

Answer:

Meryann had 6 friends at the party.

Step-by-step explanation:

Total cost = $78

Pizza cost = $24

1 Movie Ticket = $9

Movie Tickets = Total Cost - Pizza Cost

Movie Tickets = $78 - $24 = $54

No. of Friends = Movie Tickets ÷ Movie Ticket

No. of Friends = $54 ÷ $9 = 6

No. of Friends = 6

which side is opposite the middle size angle give the letter name ​

Answers

Answer:

opposite of 55 degrees would be KL

opposite of 97 degrees would be ML

opposite of 28 degrees would be MK

Step-by-step explanation:

mark me brainliest if right!!!








Using the part-whole meaning of a fraction, find the larger of each. Write down your explanation. 12 10 d. and and f. and 101 19

Answers

we can conclude that 12/17 is the larger fraction between 12/17 and 12/19 using the part-whole meaning of a fraction.

To determine which fraction is larger between 12/17 and 12/19 using the part-whole meaning of a fraction, we need to compare the sizes of the parts (numerators) relative to the wholes (denominators) for both fractions.

Let's consider the fractions 12/17 and 12/19:

For 12/17:

- The numerator, 12, represents a part of the whole.

- The denominator, 17, represents the total number of equal parts into which the whole is divided.

For 12/19:

- The numerator, 12, also represents a part of the whole.

- The denominator, 19, represents the total number of equal parts into which the whole is divided.

Since the numerators are the same (both 12) and we are comparing the fractions with the same numerator, the fraction with the smaller denominator represents larger parts or more significant portions of the whole.

Comparing the denominators, we can see that 17 is smaller than 19. This means that the whole in 12/19 is divided into fewer parts compared to the whole in 12/17. Therefore, each part of the whole in 12/17 is larger than each part in 12/19.

As a result, we can conclude that 12/17 is the larger fraction between 12/17 and 12/19 using the part-whole meaning of a fraction.

Learn more about Fraction here

https://brainly.com/question/30335970

#SPJ4

Will takes out a loan of $1400 at 4.5% interest. The loan term is 3 years, with a monthly payment of $101.89. How much interest does he
pay?

Answers

Answer:

+100 nasan yung tanong ah


Convert the binary expansion 1100101 base 2 to expansions

1a)
base 4
1b)
base 10



please explain how you got your answer as well

Answers

The binary expansion 1100101 base 2 can be converted to base 4 and base 10. In base 4, the expansion is 313 and in base 10, it is 101.

To convert the binary expansion 1100101 base 2 to base 4, we group the binary digits into pairs from right to left. Starting from the rightmost pair, we convert each pair to its equivalent base 4 digit. In this case, the pairs are 01, 01, 10, and 11, which correspond to the base 4 digits 1, 1, 3, and 3, respectively. So the base 4 expansion is 313.

To convert the binary expansion 1100101 base 2 to base 10, we can use the positional value system. Each binary digit represents a power of 2. Starting from the rightmost digit, we assign powers of 2 to each digit in increasing order from right to left. In this case, the digits are 1, 0, 1, 0, 0, 1, and 1, which correspond to the powers of 2^6, 2^5, 2^4, 2^3, 2^2, 2^1, and 2^0, respectively. Evaluating these powers of 2, we get 64, 0, 16, 0, 0, 2, and 1. we obtain 64 + 0 + 16 + 0 + 0 + 2 + 1 = 101 in base 10.

Therefore, the binary expansion 1100101 base 2 is equivalent to 313 base 4 and 101 base 10.

Learn more about binary expansion here:

https://brainly.com/question/32678181

#SPJ11

Find the number of edges on this solid.
Enter

Answers

It has 8 sides 2 in the front and back and 6 on the sides and has 12 actual edges

An edge is formed when two faces come together. The number of edges in the given solid is 18.

What is an edge?

An edge is formed when two faces come together. A cube, for example, has 12 edges, a cylinder has two, and a spherical has none.

The number of edges in the given solid is 18.

Learn more about Edge:

https://brainly.com/question/2272331

#SPJ2

Pi is: (click all that are correct) *
always the same, and is 3.14 or 22/7
delicious
used to help find the circumference of a circle
always a different number pls help lol

Answers

yes,Pi is 3.142 or 22/7

Step-by-step explanation:

22/7=3.14285714

If a man invests $1000 in a savings account and another $1000 in a fixed deposit. If the savings account pays 4.5% interest per annum and the fixed deposit pays 6% interest per annum, find the total amount after 1 year of investment. Please I need a quick answer to this!

Answers

Answer:

Results are below.

Step-by-step explanation:

Giving the following information:

Savings account:

PV= $1,000

n= 1

i= 0.045

Fixed Deposit:

PV= $1,000

n= 1

i= 0.06

To calculate the future value, we need to use the following formula:

FV= PV*(1+i)^n

Savings account:

FV= 1,000*1.045^1

FV= $1,045

Fixed deposit:

FV= 1,000*1.06^1

FV= $1,060

Azim wants to buy a tablet computer that is priced at $255 25. If the sales tax rate on the computer is 8%, how many dollars and cents will Azim spend on the sales tax only?​

Answers

8% of $255.25 is $20.42

PLSS HELP MEE AND NO BOTS I WILL REPORT Find the equation of the line below. If necessary, use a slash (/) to indicate a
division bar.
(6,1)

Answers

The answer is 1/6 I think that is correct

Can someone pls help me ASAP I’ll give brainiest


Also show how u got the answer step by step pls

Answers

3^x+1=3^3
X+1=3
X=3-1
X=2

What function is shown in the graph?
A)
y=-3X
B)
B
y = 3-X
0
y = 3x + 2
D)
y = 3* + 2

Answers

Answer:

5x

Step-by-step explanation:

got it right on edg

The table shows the monthly salaries for employees at a company.

a. Find the mean, median, and mode of the data.

The mean is $
. The median is $
. The mode is $
.


Question 2
b. Each employee receives a 5% raise. Find the mean, median, and mode of the data with the raise. How does this increase affect the mean, median, and mode of the data? Round to the nearest cent.

The mean is $
The median is $
The mode is $

The raise increases the mean, median, and mode by
%.


Question 3
c. Use the original monthly salaries to calculate the annual salaries. Find the mean, median, and mode of the annual salaries. How are these values related to the mean, median, and mode of the monthly salaries?

The mean is $
. The median is $
. The mode is $
.

These values are ____ times the mean median, and mode of the monthly salaries.

(Also please explain how you got the answers.)

Answers

Answer:

30

Step-by-step explanation:

30

The mean, median, and mode of the given monthly salary is 1794, 1790, and 1940, respectively.

What is the measure of central tendency?

Measures of central tendency assist in the discovery of a data set's middle, or average. The mode, median, and mean are the three most popular metrics of central tendency.

Mode: It is the most common value in a given data set.

Median: In an ordered data set, the median is the number in the middle.

Mean: It is the total number of values divided by the sum of all values.


For the given data, the mean, median and the mode of the data can be found as shown below,

Sum of the Observations

= 1940 + 1660 + 1860 + 2100 + 1720 + 1540 + 1760 + 1940 + 1820 + 1600

= 17940

Number of Observations = 10

The mean of the data is,

Mean = Sum of Observations / Number of Observations

          = 17940 / 10  
          = 1794

The median of the data can be found by arranging the data in an order first. Therefore, the data can be arranged as,

1540160016601720176018201860194019402100

The median of the data is,

Median = (Sum of the two mid values) / 2

             = (1760 + 1820) / 2

             = 1790

The mode of the data is 1940, since this is repeated twice.

b.

If the salary of each employee is increased by 5% that means that the value of each observation in the data will increase by 5%. Therefore, The raise increases the mean, median, and mode by 5% each.

c.

As it is now required to find the mean, median, and mode of the annual salary; there is a need to multiply the monthly salary of each employee by 12. Therefore, the value of each observation will be 12 times its original value. These values are 12 times the mean median, and mode of the monthly salaries.


Learn more about the Central Tendency here:

https://brainly.com/question/17330554


#SPJ3

the factors. 2. Fill in the blanks with appropriate word(s) or numbers. a) 6x 10³ +3× 10 + 4 x 10-2is written in standard form as b) Four hundred seven and thirty-four thousandths in standard form is written as c) 86.00405 is written in words as d) (3x*y) written without negative exponents is e) 0.0675= % f) 44% is the same as the fraction in simplest form. g) When you multiply a natural number by a decimal, when do you get a result more than that number? h) 13.982 rounded to the nearest tenths is i) 4 tens minus 4 tenths = (write the answer in standard form)

Answers

Answer:

answer is a

Step-by-step explanation:

first solve

solve for gcf

flip

divide

then you add

and you get 0.928838

Using the example 2 2 4
3 3 4
•= •and a math drawing, explain why multiplying the numerator and
denominator of a fraction by the same number results in the same number (equivalent fraction).
In your explanation, discuss the following:
• what happens to the number of parts and the size of the parts;
• how your math drawing shows that the numerator and denominator are each multiplied by 4;
• how your math drawing shows why those two fractions are equal.

Answers

When you multiply the numerator and denominator of a fraction by the same number, you are effectively scaling up or scaling down the fraction without changing its value. The math drawing demonstrates how the number of parts and the size of the parts change, while still representing the same amount, thus showing why the two fractions are equal.

To explain why multiplying the numerator and denominator of a fraction by the same number results in an equivalent fraction, let's use the example you provided: 2/4.

First, let's understand the concept of a fraction. A fraction represents a part of a whole. The numerator represents the number of parts we have, and the denominator represents the total number of equal parts that make up the whole.

In the given example, 2/4, the numerator is 2, indicating that we have 2 parts out of a total of 4 equal parts. The denominator tells us that the whole is divided into 4 equal parts.

Now, let's say we want to multiply both the numerator and denominator by the same number, let's say 4. The new fraction becomes (2 * 4) / (4 * 4), which simplifies to 8/16.

Let's visualize this using a math drawing. Consider a rectangular shape representing the whole, divided into 16 equal parts, like a grid of squares, with 8 of those squares shaded. This represents the fraction 8/16.

Now, let's compare this to the original fraction, 2/4. If we draw a rectangle divided into 4 equal parts, and shade 2 of those parts, we can see that it represents the same amount as the fraction 8/16. By multiplying both the numerator and denominator by 4, we have essentially scaled up the size of each part and increased the number of parts.

Visually, the original fraction of 2/4 had fewer total parts (4) but larger-sized parts, while the equivalent fraction of 8/16 had more total parts (16) but smaller-sized parts. However, the total shaded area in both cases remains the same, which indicates that the fractions are equal.

To know more about equivalent fraction, refer to the link below:

https://brainly.com/question/29796627#

#SPJ11

3. Which property justifies rewriting
2r-7x
*(2-7) ?
OA. Associative property of multiplication
OB. Distributive property
OC. Commutative property of multiplication
O D. Associative property of addition

Answers

B distributive property

A random sample of 750 US adults includes 330 that favor free tuition for four-year colleges. Find the margin of error of a 98% confidence interval estimate of the percentage of the population that favor free tuition O 7.7% 04.2% O 1.8% O 3.5% O 3.7%

Answers

Therefore, the margin of error of a 98% confidence interval estimate of the percentage of the population that favor free tuition is 4.2%.

The margin of error is the difference between the sample statistic and the population parameter. It shows how much the sample result can deviate from the actual population parameter.Here, the sample size n = 750, and the proportion of adults in the US who favor free tuition for four-year colleges is p = 330/750 = 0.44.Using the z-distribution, we can calculate the margin of error for the 98% confidence interval as follows:zα/2 = z0.01/2 = 2.33margin of error = zα/2 * √(p(1-p)/n)margin of error = 2.33 * √(0.44(1-0.44)/750)margin of error ≈ 0.042 or 4.2%Therefore, the margin of error of a 98% confidence interval estimate of the percentage of the population that favor free tuition is 4.2%.

To know more about percentage,

https://brainly.com/question/24877689

#SPJ11

what equation represents this sentence?
0.7 increased by a number is 3.8.

a. 3.8 n = 0.7
b. 3.8 + n, = 0.7
c. 3.8n = 0.7
d. 0.7 + n = 3.8

Answers

The equation that represents the sentence "0.7 increased by a number is 3.8" is d) 0.7 + n = 3.8

To understand why this equation is the correct representation, let's break it down. The phrase "a number" can be represented by the variable n, which stands for an unknown value. The phrase "0.7 increased by" implies addition, and the number 0.7 is being added to the variable n. The result of this addition should be equal to 3.8, as stated in the sentence.

Therefore, we have the equation 0.7 + n = 3.8, which indicates that when we add 0.7 to the unknown number represented by n, we obtain a value of 3.8. This equation accurately captures the relationship described in the sentence, making option d, 0.7 + n = 3.8, the correct choice.

To know more about equation refer here:

https://brainly.com/question/29657992

#SPJ11

The area of a rectangle is 45.5 square inches. The base of the rectangle is 7 inches. What is the height of the rectangle in inches?

Answers

Answer:

B: 6.5 inches

Step-by-step explanation:

Given,  

Area of the rectangle = 45.5 sq. inches  

The Base of the rectangle = 7 inches  

 

45.5 = l * 7  

l = 45.5/7

l = 6.5 inches

Answer:

silly billy your a tree with branches and leaves hogwarts has an olw that deleivers letters

Step-by-step explanation:

What is the solution to this system

Answers

Answer:

(1, - 1)

Step-by-step explanation:

The solution to a system of equations given graphically is at the point of intersection of the 2 lines.

The lines intersect at (1, - 1)

Then (1, - 1 ) is the solution to the system.

Two sides of a triangle measure 8 cm and 15 cm. Whi[:h could be the length of the third side?
O 6 cm
O 18 cm
O 24 cm
O 28 cm

Answers

18 cm is correct .

Step-by-step explanation:

The sum of two smaller sides is greater that the largest side.

It is given that the two sides of a triangle measure 8 cm and 15 cm.

Case 1: Let 8 cm and 15 cm. are smaller side. So,

Third side < 8 + 15

Third side < 23

It means 3rd side must be less than 23

Case 2: Let 15 cm is the largest side.

15 < Third side + 8

15 - 8 < Third side

7 < Third side

It means 3rd side must be greater than 7.

Since only 18 is less than 23 and greater than 7, therefore the possible length of third sides is 18 cm and option 2 is correct.

I need help math is so ACK anyone know the answer

Answers

Answer:

He should have done 8^2 + 15^2= x^2 because the hypotenuse is always the longest side and in Pythagorean theorem C represents the longest side

[tex] {x}^{2} = {(8)}^{2} + {(15)}^{2} [/tex]

[tex] {x}^{2} = 64 + 225[/tex]

[tex] {x}^{2} = 289[/tex]

[tex]x = \sqrt{289} [/tex]

[tex]x = 17[/tex]

Other Questions
Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan. find the two x-intercepts of the function f and show that f '(x) = 0 at some point between the two x-intercepts. f(x) = x x 2 There are 20 problems in a mathematics competition. The scores of each problem are allocated in the following ways: 3 marks will be given for a correct answer. I mark will be deducted from a wrong answer and O marks will be given for a blank answer. Find the minimum number of candidate(S) to ensure that 2 candidates will have the same scores in the competition. In which of the following instances would the independence of the CPA not be considered to be impaired? The CPA has been retained as the auditor of a brokerage firmA. Which owes the CPA audit fees for more than one year.B. In which the CPA has a large active margin account.C. In which the CPA's brother is the controller.D. Which owes the CPA audit fees for current year services and has just filed a petition for bankruptcy. The dataset catsM is found within the boot package, and contains variables for both body weight and heart weight for male cats. Suppose we want to estimate the popula- tion mean heart weight (Hwt) for male cats. We only have a single sample here, but we can generate additional samples through the bootstrap method. (a) Create a histogram that shows the distribution of the "Hwt" variable. (b) Using the boot package, generate an object containing R=2500 bootstrap samples, using the sample mean as your statistic. 8 class monitors march and hoist the school flag on a Monday. They walk in a line so that every monitor except the first is preceded by another. On Tuesday, to avoid everyone seeing the same person immediately in front of them, they decide to switch positions so that no monitor is preceded by the same person who preceded him on Monday. In how many ways can they switch positions to satisfy this condition? richard walks at 5.0 mph on three days per week. on each day that he walks at 5.0 mph, he walks for 30 minutes. after each walk, richard consumes approximately 200 calories of fruits and vegetables. how many met minutes per week does richard spend walking at 5 mph? The current ratio is measured by Current assets / Current liabilities. Assume this ratio is greater than 100% (or 1:1) and that the cash balance remains positive at all times. State the effect the fol Blue Wave Co. predicts the following unit sales for the coming four months: September, 3,900 units, October, 4,500 units, November. 6,100 units; and December, 8,000 units. The company's policy is to m Example Given the supply function P=10+ vg Find the price elasticity of supply. (a) Averaged along an arc between Q=100 and Q=105 (b) At the point Q=100. The following data were collected from a sample of fathers and sons. The heights are given in inches. Construct a 95% confidence interval for the slope of the regression line. Round your answers to two decimal places, if necessary.Heights of Fathers and Sons (in Inches)Height of Father, x: 65, 67, 66, 71, 65, 70, 73, 71, 69Height of Son, y: 69, 67, 68, 73, 65, 73, 76, 73, 70