Question 1

A. Explain the different factors that affect modes of entry into international business. In relation to this attempt to assess the potential reasons for going international by Ethiopian business organizations/enterprises.

B. Briefly explain the different modes of entry into international business and suggest those that could best work for Ethiopian international traders or investors.

Question 2

Thoroughly explain the concept, causes, blessings and curses of globalization. In view of this argue against or for regarding the decision of Ethiopia to join WTO as a member country.

Question 3

• Why a country should engage in international business? Substantiate your argument with at least four theories of international trade.

Question 4

A. What do we mean by international business, multinational business, global business and transnational business? Clearly present the differences that underlie them.

B. Where do you generally categorize Ethiopian businesses that are currently operating in the international trade/investment arena? Why?

Question 5

Explain the concept of country of origin effect in the conduct of international business. Assess its impact on developing countries like Ethiopia and suggest some potential remedies to minimize those impacts that are of negative.

Answers

Answer 1

The different factors that affect modes of entry into international business.

Market size and potentialLevel of riskInvestment requirementsDegree of controlLegal and regulatory environment

1b. There are several modes of entry into international business, including exporting, licensing, franchising, joint ventures, and direct investment. Ethiopian international traders or investors may choose to enter a foreign market through exporting, which involves selling goods or services to customers in other countries without establishing a physical presence there. Licensing involves allowing a foreign company to use a company's intellectual property (such as trademarks, patents, or technology) in exchange for royalties. Franchising involves allowing a foreign company to use a company's business model and brand in exchange for a fee.

2. Globalization refers to the increasing interconnectedness and interdependence of countries through the exchange of goods, services, ideas, and culture. It is driven by advances in transportation, communication, and technology, as well as liberalized trade policies and the removal of barriers to cross-border investment. The blessings of globalization include increased economic growth, greater access to a wider range of goods and services, and the sharing of knowledge and technology. The curses of globalization include the displacement of workers and the loss of jobs in some industries, as well as the potential for increased income inequality and cultural homogenization.

3. A country should engage in international business for several reasons. First, international trade can help a country to access a wider range of goods and resources, which can improve the standard of living for its citizens. Second, international trade can help to stimulate economic growth and development, as it allows a country to specialize in the production of certain goods and services in which it has a comparative advantage. Third, international trade can help to diversify a country's economy and reduce its reliance on a single industry or market. Fourth, international trade can help to expose a country's firms to new ideas and technologies, which can lead to increased innovation and competitiveness.

4. International business refers to business activities that involve the exchange of goods, services, or resources across national borders. Multinational business refers to a company that operates in multiple countries and has a significant presence in each of those markets. Global business refers to a company that operates in multiple countries and has a centralized, global approach to its operations. Transnational business refers to a company that operates in multiple countries and has a decentralized, local approach to its operations, with a focus on adapting to local conditions and customs.

B. Ethiopian businesses that are currently operating in the international trade/investment arena could be considered multinational or transnational businesses. This is because many of these businesses have a strong presence in Ethiopia and are also expanding into other countries, but they also tend to have a focus on local adaptation and building relationships with local partners.

5. The country of origin effect refers to the influence that a product's country of origin has on consumer perceptions and purchasing decisions. This can affect developing countries like Ethiopia in a number of ways. On the other hand, if a country has a reputation for producing high-quality goods or for having strict labor and environmental regulations, it may be easier for companies from that country to sell their products overseas. Potential remedies to minimize the negative impacts of the country of origin effect on developing countries include improving the quality and reputation of products, investing in marketing and branding efforts to promote the country's image, etc.

What is the mode of entry about?

There are several factors that can affect the mode of entry that a business chooses when entering the international market. Some of the main factors include:

Market size and potential: The size and potential of the target market can influence the mode of entry. Level of risk: The level of risk associated with a particular mode of entry can also be a factor in the decision-making process.

In relation to Ethiopia, potential reasons for Ethiopian business organizations/enterprises to go international could include seeking new markets for their products or services, accessing new sources of raw materials or technology, and expanding their operations to take advantage of economies of scale. The specific mode of entry chosen by an Ethiopian business may depend on a combination of the above factors, as well as the specific goals and resources of the business.

Learn more about international business from

https://brainly.com/question/4979112
#SPJ1


Related Questions

Refer to Situation 4-1. Because price controls were in effect at the time the embargo occurred, an economist would predict that a. the number of dollars one would need to pay at the pump for a full tank of gasoline would increase sharply. b. the number of dollars one would need to pay at the pump for a full tank of gasoline would decline sharply. c. long waiting lines and black markets would appear. d. a surplus of gasoline would result.

Answers

An economist would forecast that the price of a full tank of gasoline would rise significantly at the pump because price limits were in place at the time the embargo took place. ( Option a )

- According to the Smithsonian National Museum of American History, in 1973, the Organization of Petroleum Exporting Countries (OPEC) punished the United States for its support of Israel by imposing a crippling embargo that caused a 350% increase in oil prices. A gallon of gasoline cost 36 cents in 1970. It has more than tripled to $1.19 by 1981.

- According to the Bancroft Library at the University of California, Berkeley, the first of the gas panics of the 1970s started in October 1973 when OPEC increased the price of crude oil by 70%.

To know more about OPEC, kindly click on the link below :

https://brainly.com/question/14305745?referrer=searchResults

#SPJ4

refer to the above table. suppose you had a budget of $7 and the price of pretzels was $2 and the price of cookies was $1. what would be the number of pretzels and cookies that you would purchase to maximize your utility given the data in the table?O 1 cookies and 3 pretzels C 6 cookies and 1 pretzels O 5 cookies and 1 pretzels O 3 cookies and 2 pretzels

Answers

In a strategic plan known as utility maximization, people and businesses aim to get the most enjoyment possible out of their financial choices. For instance, management will implement a plan of purchasing items or services that deliver the greatest advantage when a company's resources are restricted.

The utilitarian philosopher's John Stuart Mill and Jeremy Bentham created the idea of utility maximization. Alfred Marshall, an economist from England, introduced it into economics.

The cost of a product that a consumer is prepared to pay is a presumption in classical economics that approximates the greatest utility that they obtain from the acquired thing.

To learn more about utility maximization, please refer:

https://brainly.com/question/29222195

#SPJ4

describe the difference in spending between the mandatory and discretionary categories, according to the chart.

Answers

There is no need for Congress to vote each year to approve this kind of spending. Spending can be classified as either required or discretionary depending on whether it is governed by current law or put to a vote during the annual appropriations process.

What is mandatory spending?

Existing laws require mandatory spending, commonly known as direct spending. Spending of this kind also includes payments to individuals, organizations, state and municipal governments, as well as financing for entitlement programs like Medicare and Social Security.

The three largest entitlement programs in the country—Social Security, Medicare, and Medicaid—as well as numerous smaller ones—like deposit insurance, student loans, and retirement plans for government employees—require obligatory spending.

Thus, There is no need for Congress to vote each year to approve this kind of spending.

For more information about mandatory spending, click here:

https://brainly.com/question/12602941

#SPJ4

Emme was telling her friend about the freedom and scretion given to her in scheduling and deciding the procedures used to complete the tasks assigned to her. Which of the following job characteristics was she talking about? O task signbifficence
O autonomy
O task identity
O skill variety O feedback

Answers

Autonomy is the job characteristic she was talking about. Autonomy is when a person has the freedom to decide how to do their job and when to do it.

What is Autonomy?

Autonomy is the ability to self-govern and make decisions independently. It is a concept that emphasizes the importance of individual autonomy and self-determination. Autonomy is the right to choose how we want to live our lives, free from external control and coercion. It is a core value of many cultures and societies and is a cornerstone of democracy. Autonomy also includes freedom of thought and expression, the right to privacy, and the right to bodily integrity. Autonomy is an important concept in psychology, law, and ethics, as it involves the right to make decisions without interference. Autonomy is essential for a person to have self-respect and respect for others.

This includes being able to set their own schedule and decide the procedures used to complete tasks.

To learn more about Autonomy
https://brainly.com/question/29565041
#SPJ4

TRUE/FALSE. people sometimes do things because they think it is the fair thing to do but actions based on fairness must also be backed by real financial gains or other material or tangible benefit. even if there is no financial or other material benefit. sometimes expecting nothing in return, but most often expecting real gains also. only if they trust the other people in the transaction.

Answers

In behavioral economics, we assert that : people sometimes do things because they think it is fair thing to do , even if there are no financial or other material gains .

Define behavioral economics

The field of behavioral economics investigates the influences of psychological, cognitive, emotional, cultural, and social aspects on individual or institutional decisions, and how those decisions deviate from those predicted by traditional economic theory. In order to provide custom business plans and solutions based on psychology and market research, behavioral economic consultants first endeavor to understand their clients' needs.

You might work alone or as a member of a private firm as a consultant and select a specific industry, such as health care or education. All other first three choices are incorrect because they talk in terms of expected gains or other financial or real gains but it's incorrect as in behavior economic people act as a irrational agent, so they work differently from what is suggested by the theory .

To learn more about behavioral economics, visit:

https://brainly.com/question/7138202

#SPJ4

You buy an 8% coupon, 20-year maturity bond when its yield to maturity is 9%. (Assume semiannual coupon payments.) Six months later, the yield to maturity is 10%. What is your return over the 6 month?

Answers

If a bond's purchase price is equal to its par value, its coupon rate and yield to maturity are identical. A bond's face value, also known as the state company, is its par value. Par values for most bonds are $100 or $1,000.

A bond's interest rate, or the amount it pays the bondholder each year, is represented as a percentage of its par value and is known as the coupon rate. Until it matures, a bond with a $1,000 par value and a 5% coupon rate will accrue $50 in interest annually .Let's say you buy a bond from IBM Corp. with a $1,000 face value and $10 semi-annual installments. Divide the total yearly interest payments by the bond's face value to find the coupon rate. In this instance, the total yearly interest payment is $10 multiplied by 2 to get $20. As a result, the annual coupon rate for the IBM bond is $20 x $1000, or 2%.

No matter what price the bond trades for, the coupons are fixed.

Learn more about maturity bond here:

https://brainly.com/question/14644574

#SPJ4

The cost of merchandise sold during the year was $58,706. Merchandise inventories were $12,831 and $8,381 at the beginning and end of the year, respectively. Accounts payable were $5,017 and $4,722 at the beginning and end of the year, respectively. Using the direct method of reporting cash flows from operating activities, find the total cash payments for merchandise. Select the correct answer. a. $5,017 b. $58,706 c. $54,551 d. $53,961

Answers

Using the direct method of recording cash flows from operating activities, the total amount paid in cash for items is $53,961. So, the appropriate choice is (d)

For the direct method of reporting cash flows from operating operations, we can perform the following computation to determine the cash payments for goods:

Cash payments for merchandise = Cost of merchandise sold - (Ending inventory - Beginning inventory) - (Ending accounts payable - Beginning accounts payable)

putting the value and we get,

Cash payments for merchandise = $58,706 - ($12,831 - $8,381) - ($5,017 - $4,722)

= $58,706 - $4,450 - $295

= $53961

To know more about cash payments, click the below link

brainly.com/question/29422769

#SPJ4

an emplyerwith 200 employeeoffer health insurance coverage its employee and dependents and pays one half of emplyee premiums for what tax penalty would it be liable if two of its employees obtainedinsurance coverage through an exchange in 2022and receive a premium subsidisy forthe entire year if applicablre annual penalty amount is $4120

Answers

If the employer-sponsored coverage is not affordable or offers insufficient value and one or more full-time employees acquire exchange-subsidized coverage, the employer will be charged a penalty.

What is an employee?

A worker or manager who works for a business, group, or community is referred to as an employee. The organization's personnel consists of these people. There are various types of employees, but in general, any individual engaged by an employer to do a specific task in exchange for remuneration is considered an employee.

This means that employers must participate or pay: Offer low-cost health insurance that includes the bare minimum of coverage or face penalties. The fine for failure to comply is $2,880 or $4,320 for each full-time employee in 2023, excluding the first 30 full-time employees.

Therefore, If workers obtain exchange-subsidized insurance, the company employees will be penalized.

Learn more about employees here:

https://brainly.com/question/10369837

#SPJ1

In a trend balance sheet, each balance sheet item is expressed as a percentage of
Multiple Choice
a. the base year item.
b. equity.
c. sales.
d. total assets.

Answers

In a trend balance sheet, each balance sheet item is expressed as a percentage of total assets.

What is trend balance sheet?

Many businesses view trended balance sheets as essential month-end reports, and the finance team frequently uses them to examine monthly patterns in assets, liabilities, and equity. The most important feature of this kind of report is how the columns are dynamically populated with the months, starting with January and ending with the present period. Balance Sheet Trend Reports are used by businesses and organizations to swiftly identify upward or downward trends for any specific item on the statement. A company can increase its capacity to swiftly spot trends or exceptions and decrease the possibility that problems are discovered too late in the process with crucial things like cash, receivables, or payables by implementing solid business practices in the Finance & Accounting Department.

To know more about  balance sheet, visit

https://brainly.com/question/1113933

#SPJ4

This exercise examines the effect of a new destructive pest in Iowa on the price of corn in the United States and daily wages of corn harvesters in Nebraska. Assume that buyers of corn have no preference for corn grown in Iowa versus Nebraska. On the following graph, show the effect the new destructive pest in Iowa has on the market for corn in the United States by shifting either the demand curve, the supply curve, or both. Based on the graph for the market for corn in the United States, the new destructive pest has caused the price of corn in the United States to The following graph shows the daily market for corn pickers in Nebraska. Show the effect of the change in the price of corn in the United States on the market for corn pickers in Nebraska by shifting either the demand curve, the supply curve, or both. LABOR (Thousands of workers)

Answers

According to the demand schedule, quantity required reduces as price increases and vice versa.

What is demand curve?

In economics, a demand curve is a chart that depicts the relationship between the cost of a given commodity and the quantity that is demanded at that price. Levels can increase can be used to analyse the connection between price and quantity for a single client or for all customers in a particular market.

The demand curve is built on the demand schedule. The demand schedule details the exact quantity of units to be ordered atvarious prices of an item or service. It is significant to remember that the amount required rises as the price falls.

To know more about demand curve, visit:

https://brainly.com/question/1139186

#SPJ1

Complete the following table by indicating whether or not each scenario is an example of price discrimination. Hotels charge a higher price for rooms with a nicer view, such as a skyline view or a coastal view. Assume that all consumers receive a higher utility when staying in a room with a nicer view. Last-minute "rush" tickets can be purchased for most Broadway theater shows at a discounted price. They are typically distributed via lottery or on a first-come, first-served basis a few hours before the show. Assume that the theater in questions does not hold seats in reserve for this purpose, but rather offers rush tickets only for seats not before the day of the performance.

Answers

In first case we can see in case that hotel is charging same price to anyone who wants to stay in a NICER VIEW. and demand same amount of money. So there is no price discrimination.

What is meant by price discrimination?

Price discrimination is a selling strategy that charges customers different prices for the same product or service based on what the seller thinks they can get the customer to agree to. In pure price discrimination, the seller charges each customer the maximum price they will pay.

Why is price discrimination used?

Companies practice price discrimination in order to maximize profits. Since a large market typically includes many types of consumers, price discrimination allows companies to offer a high price to well-off consumers and a low price to the most price-sensitive consumers.

To know more about price discrimination visit:

https://brainly.com/question/14969650

#SPJ4

The company's adjusted trial balance includes the following accounts balances Cash, $15,000, Equipment, $85,000, Accumulated Depreciation, $25,000, Accounts Payable, $10,000; Retained earnings, $63,500, Dividends, $2,000, Sales, $56,000 Sales Returns and Allowances, $3,000 Sales Discounts, $1,500, Depreciation Expense, $25,000 and Salaries Expense, $23,000 All accounts have normal balances Prepare the second closing entry by selecting the account names from the pull down menus and entering dollar amounts in the debit and credit columns.

Answers

DEBIT: INCOME SUMMARY $52,500 (depreciation expense $25,000 + Salaries expense $23,000 + sales discounts $1,500 + sales and returns an allowances $3,000 = total income of $52,500) Credit sales discounts $1,500, sales returns and allowances $3,000, depreciation expense $25,000 salaries expense $23,000

First Knowledge Check The following account balances are included in the company's adjusted trial balance: Accounts Payable: $10,000; Equipment: $85,000; Accumulated Depreciation: $25,000; Retained Earnings: $63,500; Dividends: $2,000; Sales: $56,000 Sales Allowances and Returns, $3,000 $1,500 in sales discounts, $25,000 in depreciation costs, and $23,000 in salary costs. All accounts are balanced normally. By choosing the account names from the pull-down options and entering dollar amounts in the debit and credit fields, you may prepare the second closing entry. look at the transaction list Worksheet for journal entries The following account balances are included in the company's adjusted trial balance: $15,000 in cash; $85,000 in equipment; $25,000 in accumulated depreciation; $10,000 in accounts payable; and $63,500 in retained earnings. $2,000 in dividends, $56,000 in sales, and $2,000 in sales returns and allowances Note: List debits first, then credits. Dec. 31 Debit Credit General Journal

Learn more about depreciation  here:

https://brainly.com/question/15085226

#SPJ4

FILL IN THE BLANK the___(the interest rate banks charge each other on overnight loans) is highly sensitive to money market factors and well exemplifies the interaction of supply and demand for banking funds.

Answers

The fed fund rate (the interest rate banks charge each other on overnight loans) is highly sensitive to money market factors and well exemplifies the interaction of supply and demand for banking funds.

What interest rate do banks charge one another for short-term and overnight loans?

far, or the federal funds rate The interest rate that banks charge one another for overnight loans of $1 million or more is known as the federal funds rate. This rate is said to be the most variable of all the benchmark interest rates because overnight loans are the shortest and short-term interest rates are the most volatile.

Quizlet: What is the overnight interest rate and what function does it serve in monetary policy?

The interest rate that banks charge one another for loans in the overnight funds market is known as the overnight interest rate. In that market, loans are frequently made for relatively short periods of time—often just one day.

To Know more about fed fund rate

https://brainly.com/question/17305041

#SPJ4

Citron is a firm that manufactures electric scooters. Suppose Citron sells its electric scooters to online retailers for $810 each and requires those online retailers to charge at least $840 to shoppers for each electric scooter. Warm Winds is the only firm producing air fryers. It costs $410 to produce one air fryer, and Warm Winds sells each air fryer for $950. After Sirocco, a new firm with the same costs as Warm Winds, enters the market for air fryers, Warm Winds starts selling its air fryers for a price of $330. Wallyâs sells a wide variety of skateboards to retail sporting good outlets. Wallyâs recently rolled out two new skateboards: a popular Dallas II and a much less popular Drydeck 3. Wallyâs requires sporting good outlets to order 15 boards of the Drydeck 3 for every 120 boards of the Dallas II bought. True or False: The only reason for Citron to require retailers to sell electric scooters at a certain price is to reduce competition and extend its market power to the retail market. Therefore, this practice is always economically inefficient.
True
False

Answers

False. The practice of requiring retailers to sell electric scooters at a certain price does not necessarily reduce competition or extend market power.

What is extend market power?

Extend market power is a term used to describe the ability of a company to influence the market and increase its market share. It refers to the ability of a company to control a larger portion of the market, allowing them to charge higher prices, increase their profits and control the market for a certain product or service. This is often done through aggressive marketing and advertising campaigns, the utilization of strategic alliances and partnerships, and the development of new products and services which cater to a specific market. Companies can also use their extended market power to influence the pricing of products and services within their industry, as well as influence the competition.

It may be done for many reasons, including increasing revenue by capturing a larger share of the market or protecting brand reputation. In some cases, this practice may even be economically efficient, such as when it helps the firm capture a larger share of the market or protect its brand reputation.

To learn more about extend market power
https://brainly.com/question/29766212
#SPJ4

An investor obtained a fully amortizing mortgage five years ago for $96,400 at 11 percent for 30 years. Mortgage rates have dropped, so that a fully amortizing 25-year loan can be obtained at 10 percent. There is no prepayment penalty on the mortgage balance of the original loan, but three points will be charged on the new loan and other closing costs will be $2,000. All payments are monthly. Should the borrower refinance if he plans to own the property for the remaining loan term? Assume that the investor borrows only an amount equal to the outstanding balance of the loan.

Answers

A completely amortized loan is one in which the interest is computed at a set rate throughout the payback duration. The principle and interest installment payments are similarly set.

This program is available to qualifying applicants at a discount of 12% off our existing 30-year fixed-rate mortgage package. For the first 120 installments, the interest rate is fixed (10 years). After ten years, the interest rate will be changed to our current 30-year fixed rate, not to exceed 3% over the promotional rate but not less than the introductory rate. Your principle and interest payments will be adjusted proportionately beginning with the 121st payment and will stay constant for the remainder of the loan's duration (20 years).This loan can be used to purchase a single-family detached home, condominium, or townhouse as a primary or secondary dwelling. (Mobile houses and manufactured homes are not eligible.)

To know more about amortized loan:

https://brainly.com/question/29423025

#SPJ4

A broker advised his seller-client, who is selling his principal residence, to provide a completed seller disclosure notice as required by the texas property code. he should also advise the seller, that if a buyer does not receive the disclosure prior to signing a sales contract, the

Answers

The broker should advise the seller that they must provide a completed Seller Disclosure Notice as required by the Texas Property Code.

The broker should also explain to the seller that they must provide the disclosure notice to potential buyers prior to signing a sales contract. If the buyer does not receive the disclosure, they may have up to three days after signing the sales contract to terminate the contract without any penalty.

The broker should also explain that failure to provide the disclosure notice could result in a lawsuit against the seller. Additionally, the broker should remind the seller to read the disclosure form carefully and answer all questions truthfully.

For more questions like Seller disclosure click the link below:

https://brainly.com/question/28286936

#SPJ4

Make a reDemarco and Tanya have received information about three separate mortgage offers. In two or three paragraphs, describe your recommendation for the best financial choice in their situation. Evaluate each of the three offers, compare and contrast their effectiveness, and explain the offer that works best. As you explain your answer, support it using reasons and evidence from the calculations you made based on the information provided in this guide for Analyzing Mortgage Options.

commendation to Tom. Which loan should he use?

Answers

When you and a lender enter into a mortgage, the lender is granted the power to seize your property if you are unable to pay back the loan amount plus interest. Hence option 3 should be opt .

What is Mortgage ?

To purchase a property or borrow money against the value of a home you currently own, you can use a mortgage loan.

With regard to Mortgage Option 3, not only is the interest rate greater (4.0%) but also the unpaid debt must be paid in full within 8 years. After the down payment, their monthly payment would be $1,605, which would also include the 4.25% fixed interest rate.

A borrower runs the danger of losing their house and equity because of the short payment period if the final payment isn't made on time.not possible to make. The interest rate for Mortgage Option 2 is the lowest at 3.5%, although this rate may change yearly.

They would be able to pay it even though the interest rate is the highest. Tanya and Demarco would be able to make these payments and still have about $3,395 of their monthly income available for spending.

Learn more about Mortgage here

https://brainly.com/question/24423697

#SPJ1

A country currently exports 1 million tons of lumber to the rest of the world. If the government’s were to impose an export subsidy, what would be the expected result

Answers

The expected result of providing an export subsidy is the subsidy will increase exports of lumber because it will effectively lower lumber prices for consumers and raise them for producers.

What does a subsidy on exports do?

Export subsidies, such as the EU export refunds and the US Export Enhancement Program, are payments made to traders to make up the price differential between domestic market prices and international market prices. An export subsidy increases producer excess in the export market while decreasing it in the market of the importing country. When a big country introduces an export subsidy, national well-being suffers.

If the government implemented an export subsidy, the exporter market's production surplus would increase and consumer surplus would decrease. As a result, the economy will experience losses in consumption and deadweight production. Export subsidies benefit the domestic companies that receive them and frequently also result in a reduction in the price that domestic consumers pay.

To learn more about export subsidy, visit:

https://brainly.com/question/28590941

#SPJ1

Answer:. The subsidy will increase exports of lumber because it will effectively lower lumber prices for consumers and raise them for producers.

Explanation:

which of the following rankings lists these assets from the least liquid to the most liquid? responses cash, bonds, house, savings account cash, bonds, house, savings account bonds, house, savings account, cash bonds, house, savings account, cash savings account, cash, bonds, house savings account, cash, bonds, house house, bonds, savings account, cash house, bonds, savings account, cash cash, savings account, bonds, house

Answers

House, bonds, savings account, cash among the following rankings lists these assets from the least liquid to the most liquid.

A bond is what?

Bonds are a common form of capital raising used by both governments and enterprises. In essence, you are making a loan to the issuer when you buy a bond. In exchange, they promise to pay you interest on the bond on a regular basis, usually twice a year, and to pay back the loan's face amount on a specific date.

How do bonds generate profits?

Bonds are one category of investment referred to as fixed-income securities. They are debt obligations in which an investor lends money (the principal) to an organization or an authority for a certain period of time in exchange for a regular stream of interest payments (the yield).

To know more about Bonds visit:

https://brainly.com/question/17405470

#SPJ4

a company purchased inventory on account for $280,000. the company returned $26,000 of the inventory to the supplier for credit.

Answers

The journal entry of the company with purchased inventory on account for $280,000 is stated below:

What is a journal entry?

A journal entry serves as a record of a company transaction in your accounting records. Every transaction in double-entry bookkeeping requires at least two journal entries. A bookkeeper keeps track of all the changes that a transaction can bring about in a firm by recording them in a diary.

Each journal entry includes information crucial to one specific business transaction, such as the date, the amount to be credited and debited, a succinct explanation of the transaction, and the accounts impacted. It may include a list of the impacted subsidiaries, tax information, and other details, depending on the business. The journal entry of the company is:

(1)

Purchases $280,000

Accounts payable $280,000

[To record purchases on account]

(2)

Accounts payable $26,000

Purchases returns $26,000

[To record purchase returns]

To learn more about journal entry, visit:

https://brainly.com/question/29315397

#SPJ4

The complete question is attached below:

on march 1, a designer received a check for $7,500 from a customer for services to be provided after the customer chooses a color scheme for the first floor of her house. on july 31, the designer completed the design work for this customer.

Answers

Due to incomplete work in March, the money was not generated; therefore, it was transferred to the Unearned Revenue account.

Date                   Account Title                                          Debit               Credit

March 1              Cash                                                      $7,500

                         Unearned Revenue                                                      $7,500

Date                   Account Title                                          Debit               Credit

July 31                Unearned Revenue                              $7,500

                          Design Services Revenue                                         $7,500

Now that the designer may recognise the revenue, it will be transferred from the Unearned revenue account to the appropriate revenue account when they are finished in July.

To learn more about Unearned Revenue please click on below link

https://brainly.com/question/28494500

#SPJ4

if foreign financial investors no longer see country a as a safe haven, which of the following will most likely occur in the short run?

Answers

Prices rise during inflation to encourage consumers to spend more money on fewer goods, which results in a decline in currency value .

Political unrest is another factor that lowers currency values since it makes exchange rates more volatile. Since imports are more economical than domestic goods in this situation, they are probably more prevalent. As a result, when the actual consumers rate is high, imports rise and net exports fall. Depreciation occurs as a result of supply and demand in a free foreign exchange market value; on the one side, devaluation occurs when a government adopts monetary policy to lower the value of a currency.

To learn more about value, click here.

https://brainly.com/question/10416781

#SPJ4

Larry Mattingly turned 20 years old today. His grandfather had established a trust fund that will pay him $120,000 on his next birthday. However, Larry needs money today to start his college education, and his father is willing to help. Mr. Mattingly has agreed to give Larry the present value of the $120,000 future cash inflow, assuming a 6 percent rate of return.
Determine the amount of cash that Larry Mattingly's father should give him.

Answers

There should be $113,207.55 in cash given to Larry Mattingly by his father.

What Is Present Value (PV)?

The present value, or PV, of a future sum of money or stream of cash flows is their current value at a specific rate of return. Future cash flows are discounted at the discount rate, so the higher the discount rate, the lower the present value of the future cash flows will be. The current value of a future sum of money is known as its present value. The sum that would be paid today for a promise to pay you, for example, $110 in a year is known as the present value.

How are current values determined?

The formula for current value, divides the future value FV by a factor of 1 + I for each interval between the present and future dates.

Present value= [tex]\frac{Future value}{(1 + r)^{n} }[/tex]

Future value= $120,000

Rate (r)= 6%= 0.06

time (n)= 1 year

Present value= [tex]\frac{120,000}{(1 + 0.06)^{1} }[/tex]

Present value= [tex]\frac{120,000}{1.06}[/tex]

Present value= $113,207.55

Learn more about present value: https://brainly.com/question/23272357

#SPJ4

Assume the following information:Current spot rate of New Zealand dollar = $.41Forecasted spot rate of New Zealand dollar 1 year from now = $.43One-year forward rate of the New Zealand dollar = $.42Annual interest rate on New Zealand dollars = 8%Annual interest rate on U.S. dollars = 9%Given the information in this question, the return from covered interest arbitrage by U.S. investors with $500,000 to invest is ____%.

Answers

Option B. 10.63, calculation for U.S. investors with $400,000 to invest to find the return from uncovered interest arbitrage.

The first step is to determine the New Zealand dollar's current value.

$400,000/$.41 in New Zealand dollars

$975,609.76 in New Zealand dollars.

The increase will be determined in the second stage using the annual interest rate on New Zealand dollars.

$975,609.76 more in New Zealand dollars (1+.08)

$975,609.76 more in New Zealand dollars (1.08)

$1,053,658.54 more in New Zealand dollars

The third step is to determine the New Zealand dollar's forward rate amount.

$1,053,658.54 in New Zealand dollars at the forward rate is equal to.42.

$442,536.63 in New Zealand dollars at forward rates

Let's now determine the profit from uncovered interest arbitrage.

Return: ($400,000 - ($442,536.63))/$400,000

Return: $42,536.63 on every $400,000.

Return=0.1063*100

10.63% of returns

With $400,000 to invest, the return on uncovered interest arbitrage for American investors is therefore approximately 10.63%.

Assume the following information: Current spot rate of New Zealand dollar = $.41 Forecasted spot rate of New Zealand dollar 1 year from now = $.45 One-year forward rate of the New Zealand dollar = $.42 Annual interest rate on New Zealand dollars = 8% Annual interest rate on U.S. dollars = 9% Given the information in this question, the return from uncovered interest arbitrage by U.S. investors with $400,000 to invest is _______ %.

A) about 11.97

B) about 10.63

C) about 11.12

D) about 13.27

E) about 18.54

To learn more about interest arbitrage please click on below link

https://brainly.com/question/16178885

#SPJ4

T/F if you are turned down for a position that you believe was a good fit, employment specialists recommend writing a rejection follow-up letter to the potential employer.

Answers

The statement is false. if you are turned down for a position that you believe was a good fit, employment specialists recommend writing a rejection follow-up letter to the potential employer.

Employment is dating among two parties regulating the provision of paid labor offerings. commonly based totally on a settlement, one birthday party, the corporation, which is probably a company, a no longer-for-earnings company, a co-operative, or every other entity, will pay the alternative, the worker, in go back for carrying out assigned work. personnel works in go back for wages, which can be paid on the basis of an hourly charge, by piecework, or an annual salary, depending on the type of work an employee does, the winning conditions of the arena, and the bargaining strength among the parties. personnel in some sectors may additionally get hold of gratuities, bonus bills, or inventory options. In a few sorts of employment, personnel may also get hold of benefits similarly to price. advantages may consist of medical insurance, housing, and disability coverage.

An unbiased contractor gives offerings to the public at huge, not simply to one business, and is liable for disbursing bills from the consumer, paying unreimbursed fees, and offering his or her very own gear to finish the job. 0.33, the connection of the events is frequently evidenced by using a written settlement that specifies that the employee is an independent contractor and isn't entitled to worker blessings; the services furnished by way of the employee aren't key to the enterprise, and the connection is not everlasting.

To learn more about Employment visit here:

brainly.com/question/1361941

#SPJ4

blank includes the owners' contributions to a company along with income earned by the company and retained to finance continued growth and product development.

Answers

The increase in a business's commitments to stockholders is called retained earnings. Businesses may retain assets generated through operations.

By business, what do you mean?

A person engaged in business is also one who makes things or provides services with the intention of selling them for a profit. Commercial Definition. A business is an entrepreneurial organization or institution that engages in commercial activity. They may be industrial, commercial, or other types.

What are the foundations of business?

You should start by learning the fundamentals of business if you want to succeed. You may build a lasting firm by studying your clients and learning about their wants and needs, but you must first develop the fundamental business skills needed.

To know more about Business visit:

https://brainly.com/question/15826604

#SPJ4

Let the price elasticity of supply for a good be 2.0, and the absolute value of the price elasticity of demand be -1.5. Which of the following is true in this case?a. Producers carry the majority of the tax burdenb. consumers carry the majority of the tax burdenc. producers and consumers carry an equal amount of the tax burdend. consumers carry the entire tax

Answers

Answer:

consumers carry the majority of the tax burden.

Explanation:

In a situation where two goods can be produced by two different people, it is possible for one person to have a comparative advantage in the production of both goods and the other person to have a comparative advantage in the production of neither good
TRUE OR FALSE

Answers

It is possible for one individual to have a comparative advantage in producing both goods in a scenario where two goods can be produced by two separate people, whereas the other person may have a comparative advantage in producing neither good FALSE.

when there are two people and each one is able to produce two goods?

It is feasible for one individual to have a comparative advantage over the other in both things when there are two people and each one is capable of generating two goods.

What is the term for the circumstance where one person's opportunity cost of producing a good is lower than that of another person's opportunity cost of producing the same good?

An instance of comparative advantage is when a person, company, or nation can provide a good or service at a lower opportunity cost than another producer.

To Know more about comparative advantage

https://brainly.com/question/13221821

#SPJ4

choose the correct term for each of the missing labels in this diagram. a. human inputs b. new information

Answers

The correct term for each of the missing labels in that diagram is a. input and b. transformation.

What is input, transformation, and output?

The input-transformation-output is a production process to produce new product.

The input is all required resources to operate production process and produce a product. This include human, material, financial, and information inputs.

The transformation is all required to use the input and give them the additional value. This include technology such as machine, manufacturing, etc.

The output is the result of input that has been given added value. This include product, profit, new information, etc.

Since, the missing a labels is in beginning of process so a labels is for input, and the b labels that in the between of input and output is transformation.

You question is incomplete, but most probably your full question was

(image attached)

Learn more about transformation here:

brainly.com/question/29553455

#SPJ4

In order to comply with federal banking regulations, you must complete and pass this training prior to offering any financial products to clients. TRUE FALSE.

Answers

This statement is true "In order to comply with federal banking regulations, you must complete and pass this training prior to offering any financial products to clients."

Associates must scrupulously abide by the Bank Secrecy Act/USA PATRIOT Act, which is intended to combat money laundering and terrorist financing while promoting any bank products. Check that the address on the customer's ID matches the address on any additional paperwork the client has submitted in order to comply.

The following two types of identification, one of which must be a photo ID or an unexpired government-issued photo ID are required of clients. Compare the address on the ID with additional supporting documents. Ask the client to present one of the thirteen documents listed in the tax software to prove their address if it's different.

To learn more about Banks, visit the link below:

brainly.com/question/14390876

#SPJ4

Other Questions
Study the image, and then choose the statement that best describes the image. OohBalloons are deflatin'Guess they look lifeless like meWe miss you on your side of the bed, mmmStill got your things hereAnd they stare at me like souvenirsDon't wanna let you out my headJust like the day that I met youThe day I thought foreverSaid that you love me But that'll last for neverIt's cold outsideLike when you walked out my lifeWhy you walked out my life?I get like this every timeOn these days that feel like you and meHeartbreak anniversary'Cause I remember every timeOn these days that feel like you and meHeartbreak anniversaryDo you ever think of me? If the driver slammed on the brakes, what could happen to the crate? If aluminum nitrate reacts with calcium phosphite, what is the balanced coefficient of aluminum nitrate? how do child laborers compare to child slaves from chocotate from children Ms. Morrison is purchasing a house and needs to finance a $150,000 mortgage fromthe bank with an annual percentage rate (APR) of 3.8%. She is financing it over 30years and making monthly payments. What is the monthly payment? Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help The area of a rectangle is 46 square inches. If the length is 4 times the width, thon findthe dimensions of the rectangle. Round off your answers to the nearest hundredth Nicole had 8 correct answers on her math test. There were 20 total questions. Enter the percent of the correct answers Nicole had. What is the slope of the line below?The image is a graph of an x-axis and a y-axis. A line is drawn which passes through the points (2,3) and (-2,-7). A. 5 B. 0.2 or 15 C. 2.5 or 52 D. 0.4 or 25 which inequality is true? lol please do it correctly, brainliest if right please dont post links no bots A city has a population of 340, 000 people. Suppose that each year the population grows by 3.75%. What will the population be after 10 years ? Use the calculator provided and round your answer to the nearest whole number. Complete the proof.Given: ABBP=CBBMProve: CBA~PBM Below shows a process that occurs in cells. The type of building blocks represented by the letters A, B, and C in this process are:A: NucleotidesB: CodonsC: Amino AcidsD: Nitrogen bases