Read the excerpt below from act 1.1 of A Midsummer Night’s Dream by William Shakespeare and answer the question that follows.

EGEUS: Happy be Theseus, our renownèd Duke! [20]
THESEUS: Thanks, good Egeus. What’s the news with thee?
EGEUS: Full of vexation come I, with complaint
Against my child, my daughter Hermia.—
Stand forth, Demetrius.—My noble lord,
This man hath my consent to marry her.— [25]
Stand forth, Lysander.—And, my gracious Duke,
This man hath bewitched the bosom of my child.
Thou, thou, Lysander, thou hast given her rhymes,
And interchanged love tokens with my child.
Thou hast by moonlight at her window sung [30]
With feigning voice verses of feigning love,
And stol’n the impression of her fantasy
With bracelets of thy hair, rings, gawds, conceits,
Knacks, trifles, nosegays, sweetmeats—messengers
Of strong prevailment in unhardened youth. [35]
With cunning hast thou filched my daughter’s heart,
Turned her obedience which is due to me
To stubborn harshness. And, my gracious Duke,
Be it so she will not here before your grace
Consent to marry with Demetrius, [40]
I beg the ancient privilege of Athens:
As she is mine, I may dispose of her,
Which shall be either to this gentleman
Or to her death, according to our law
Immediately provided in that case. [45]
THESEUS: What say you, Hermia? Be advised, fair maid.
To you your father should be as a god,
One that composed your beauties, yea, and one
To whom you are but as a form in wax,
By him imprinted, and within his power [50]
To leave the figure or disfigure it.
Demetrius is a worthy gentleman.
HERMIA: So is Lysander.
THESEUS: In himself he is,
But in this kind, wanting your father’s voice,
The other must be held the worthier. [55]
HERMIA: I would my father looked but with my eyes.
THESEUS: Rather your eyes must with his judgment look.
HERMIA: I do entreat your grace to pardon me.
I know not by what power I am made bold,
Nor how it may concern my modesty [60]
In such a presence here to plead my thoughts,
But I beseech your grace that I may know
The worst that may befall me in this case
If I refuse to wed Demetrius.
THESEUS: Either to die the death, or to abjure [65]
For ever the society of men.
Therefore, fair Hermia, question your desires.
Know of your youth, examine well your blood,
Whether, if you yield not to your father’s choice,
You can endure the livery of a nun, [70]
For aye to be in shady cloister mewed,
To live a barren sister all your life,
Chanting faint hymns to the cold fruitless moon.
Thrice blessèd they that master so their blood
To undergo such maiden pilgrimage; [75]
But earthlier happy is the rose distilled
Than that which, withering on the virgin thorn,
Grows, lives, and dies in single blessedness.
HERMIA: So will I grow, so live, so die, my lord,
Ere I will my virgin patent up [80]
Unto his lordship, whose unwishèd yoke
My soul consents not to give sovereignty.
THESEUS: Take time to pause, and by the next new moon—
The sealing day betwixt my love and me
For everlasting bond of fellowship— [85]
Upon that day either prepare to die
For disobedience to your father’s will,
Or else to wed Demetrius, as he would,
Or on Diana’s altar to protest
For aye austerity and single life. [90]

Hermia displays all of the following characteristics EXCEPT
A.
independence
B.
boldness
C.
impetuosity
D.
graciousness
E.
honesty

Answers

Answer 1
Answer
E
Explanation

Related Questions

Refer to the Newsela article “Can Eating Less Meat Cool the Climate?” The author of the PRO argument states that livestock are responsible for much of the world’s greenhouse gas emissions. Which approach does the author of the CON argument take to address this idea? HELP ASAPPPPPP

Answers

Answer:

The Environmental Protection Agency has recommended replacing meat with fruits and vegetables to reduce emissions. (B

Explanation:

What rhetorical device does Twain use by referencing this well-known proverb

Answers

Even though the proverb was not posted here, this question is still perfectly answerable.

Answer:

The rhetorical device Twain uses by referencing a well-known proverb is allusion.

Explanation:

Allusion is a figure of speech in which a reference is made to something or someone that has significance. The author does not explain much, since he/she assumes the audience knows who or what he/she refers to.

For instance, if someone says a woman is as beautiful as Helen of Troy, we would understand he/she means that woman is extremely beautiful. Helen of Troy is a famous character from the Iliad, by Homer, and she was the most beautiful woman in the world. The person making the allusion will not explain this fact, since it is well know.

Therefore, if Twain is referring to a well-known proverb, he is making an allusion to it.


I have run more marathons than

Answers

Answer:

Usan Bolt

Explanation:

I think that's how you say his name

Answer:

than what

Explanation:

a dog...a cat...

Describe how the plot of "Of Monsters and Mazes" reinterprets the
myth of Theseus and the Minotaur to tell a new story. Use two details
from each story in your response.

Answers

Душе я танцую как живу в этом смысле жизни не





В этом смысле не знаю как я
Я не хочу идти на работу е

where should I put the commas ​

Answers

Answer:

there is no need of adding punctuation

in the question it is already mentioned "if necessary" which is confirmation to this

Pls help!!

Which of the following words more likely offers a formal tone?

Select one

1.unwise

2.thoughtless

3.idiotic

4:crazy

Answers

Answer:

unwise, the others are aggressive

Answer:

Unwise

Explanation:

HELP FAST IM TIMED!!!!!!!!!!!

One of the benefits of an online dictionary is that

it is updated more regularly than a traditional printed dictionary.
its contents may vary depending on whether it is a .com, .org., or .edu website.
it may display a number of entries on one page.
it has search bars that look similar to dictionary guide words.

Answers

Answer:

I'm not sure but i'd say that its the first one (it is updated more regularyly than a traditional printed dictionary.)

Explanation:

Answer:

yep, it's 100% A

Explanation:

What is the mystery that needs to be solved in Act I of Antigone?

Answers

Answer:

The mystery is about where Antigone spent the night.

Explanation:

In the first act, Antigone comes home at dawn, which makes everyone questioning where she spent the night and what she was doing, as this was not the appropriate time for maidens to go out, nor was it right for them to stay out of the house for so long. home without a companion. Everyone starts to think that Antigone went to meet a lover and although she does not deny this suspicion, she does not say what she was doing, which leaves her way out of the mystery.

Antigone actually went out to disobey the king's rule that no one should attend her brother's funeral, however, this is only revealed during the play.

Based on dialogue in paragraph 4,5,6 which inference can the reader make about flemings character

Answers

Answer:

If you don't mind can you insert a picture so I can help you it would be helpful.

Explanation:

BRAINLIST IF ANSWER!
What makes a strong thesis statement?? quick I have 2 min to complete!!

Answers

Answer:

why is the time showing 5 hours ago ....? this is making me crazy.

Read this introductory paragraph from a student essay
and then answer the question.
Which choice best revises sentence 5 to make it a solid
thesis statement?
(1) Have you ever felt great fear but decided to face that
fear anyway? (2) There is no single definition of courage
and more than one way to show it. (3) In Heart of a
Samurai, Manjiro is faced with grave dangers. (4) In The
Boy Who Harnessed the Wind, William must overcome
disbelief and ridicule. (5) Both heroes show tremendous
courage.
O The heroes in both stories show tremendous courage
in the face of the great obstacles they face.
O The Heart of a Samurai and The Boy Who Harnessed
the Wind both deal with great obstacles that must be
faced and overcome.
O The heroes in Heart of a Samurai and The Boy Who
Harnessed the Wind both show courage in the face of
the obstacles they face.
O. Both heroes show tremendous courage that I could
only hope to have one day in the face of great
obstacles.

Answers

Answer:

C

Explanation:

Edge2021

Answer:

c

Explanation:

Reread paragraph 3. Which persuasive technique is used in this paragraph

Answers

Answer:

where is the paragraph

Explanation:

Answer:

bandwagon apeal

Explanation:

I got it right.

Which of the following most closely describes one way the author of "Wealthier than Kings" modernizes "Sonnet 29"?

The author of "Wealthier than Kings" adds more characters to make the emotions deeper than those featured in "Sonnet 29."

The author of "Wealthier than Kings" employs simpler language than that used in "Sonnet 29" while maintaining the same themes.

The author of "Wealthier than Kings" leaves out the dramatic and unrealistic change of character that "Sonnet 29" features.

The author of "Wealthier than Kings" maintains the repetitious style of "Sonnet 29" while keeping the same theme and changing the characters.

Answers

Answer:

The author of "Wealthier than Kings" leaves out the dramatic and unrealistic change of character that "Sonnet 29" features.

Explanation:

The creator of "Wealthier than Kings" goes out of the climactic and unreliable transformation of character that "Sonnet 29" characteristics. The creator of "Wealthier than Kings" reserves the redundant technique of "Sonnet 29" while maintaining the equivalent theme and developing the characteristics.

What is probably the cause of most of the accusations of witchcraft in Salem?
A. jealousy, acts of revenge, and power grabs B. a desire to overthrow the government
C. a real belief in witchcraft

Answers

Answer:

A. A couple of little girls accused woman of posessing them.

Explanation:

Most people probably kept the ball rolling, and used the witch trials as an excuse to hate on a few people.

Identify the colloquial speech.

I’m gonna do it, I just need more time.
a.
gonna
c.
more
b.
just
d.
I’m


Please select the best answer from the choices provided

A
B
C
D

Answers

A. Gonna

Hope it helps

Hurry Up

1.What is Water Mill?​

Answers

Answer:

A watermill is a mill that uses hydropower. It uses a water wheel to drive a mechanical process such as milling (grinding), rolling, or hammering.

Explanation:

Jhon wanted to get someplace quickly . would he walk vigorously? why or why not

Answers

Answer:

Yes

Explanation:

The word vigorously mean in a way that involves physical strength, effort, or energy; strenuously.

to walk faster he would use more strength and walk vigorously

(ELA) The answer choices for this question include a direct quote from the paragraph below. Which answer choice is punctuated correctly?

The first place that I can well remember was a large pleasant meadow with a pond of clear water in it. Some shady trees leaned over it, and rushes and
water-li les grew at the deep end. Over the hedge on one side we looked into a plowed field, and on the other we looked over a gate at our master's
house, which stood by the roadside; at the top of the meadow was a grove of fir trees, and at the bottom a running brook overhung by a steep bank.

A. Because the narrator mentions a master's house, I think the narrator is someone's pet.

B. Because the narrator "mentions a master's house," I think the narrator is someone's pet.

C. Because the narrator mentions a "master's house," I think the narrator is someone's pet.

D. Because the narrator mentions a master's house, I think "the narrator Is someone's pet."

Answers

Answer:

C

Explanation:

Answer:

C

Explanation:

Since master's house was originally from the paragraph, you have to put quotations around it.

Identify the error in the sentence.

I'm so incredibly tired; because I didn't sleep well last night.
a.
I'm
c.
;
b.
incredibly
d.
didn't


Please select the best answer from the choices provided

Answers

Answer:

c.   ;

Explanation:

Remove the semi-colon; no punctuation is needed there.

Answer:

the answer would be c ; bc you dont need them there

does the sentence below have a misplaced or dangling modifier?

Filled with all sort of clutter, Gregory needed a whole day to clean up the room.

A.misplaced
B. Dangling

Answers

Answer:

It has a misplaced modifier, it should be Gregory needed a whole day to clean the room filled with all sorts of clutter.

Explanation:

Just took the test

imagery in God see the truth but waits
Show me 7 or 8 imagery answers and get LOTS OF POINTS CROWN AND BRAINLYIEST ​

Answers

Answer: telletubbies!! dekndcwdmmwmdkwmkcec

Explanation: yes

Who's good at writing English essays at at least around grade 12 level?

Answers

Answer: Yes I am good at writing a grade 12 level. What do you need help with?

Explanation:

intro-What it takes to be a good friend?

Answers

Answer: A true friend will accept you for who you are, even if they don't always agree with you. They will also respect your boundaries, be honest and trustworthy, and stick with you in both good and bad times. True friends also make time for you and put in work to help keep the friendship going.

Explanation:

Answer:Be real. People are turned off by those who are constantly trying to be someone they are not. We are most comfortable around others who are comfortable in their own skin. So just be yourself. Even though you aren’t perfect, the way you handle your strengths and faults with humility and confidence will give other people permission to be real and relaxed with you, as well. Real friends are relaxed around each other.

Be honest. Keep your promises and do what you say you’re going to do. Be reliable. Nobody wants to be friends with someone who lies. And lies always have a way of coming to the light. Also, friends will say the truth to one another, even when it’s hard. The wisest man in the Bible, King Solomon, said: Faithful are the wounds of a friend, but the kisses of an enemy are deceitful. Shannon got caught up in an eating disorder until her friend called her out: I was addicted to being skinny and looking absolutely perfect. I never really understood what I was actually doing to myself until a good friend of mine talked to me about it.

Take an interest in the details of your friend’s life by being a good listener. Don’t watch television or text while your friend is sharing something with you. Most times people need more than good advice, they need someone to listen to them as they talk through their feelings. Ask them what’s going on in their life and how they feel. Mari commented: Kyler is my best friend because he listens. No matter what is going on he is genuinely interested in how I am. He always has my back and would drop everything if I needed him.

Make time for your friend. Time is one of the greatest gifts we possess. When we share extra time with a friend, we are giving back to them that gift. No friendship can develop overnight. It takes time. A real friend will take that time.

Keep their secrets. Prove yourself to be a trustworthy person who will guard their secrets with your life. A good way to prove you are trustworthy is to be free to share some of your own secrets with your friend. King Solomon also said:  Friends come and friends go, but a true friend sticks by you like family. Are you willing to be a friend like that?

Explanation:

false dilemma definition

Answers

Answer:

A False Problem

Explanation:

Hope this helps :)

Answer: A false dilemma is a type of informal correlative based fallacy in which a statement falsely claims or assumes an either or situation, when in fact there is at least one additional logically valid.

The television does not go out until after Diana Moon Clampers shoots and threatens people most likely because .

Answer choices for the above question

A. those in charge know that the viewing public craves watching violence

B. it was most likely an accident that the signal aired the shooting

C. the government wants the public to witness that the authorities are still in control

D. the authorities are trying to protect the families of the victims

Answers

Answer:

c

Explanation:

i just wanted to say make sure to be on your toes i might do a give might not heres 50

Answers

Answer:

ok

Explanation:

Answer:

Gimme.

I'm trying very hard to rank up, so free points help. Although this may count as cheating, it boosts high-ranking users like Experts so that they can become the next highest rank.

Explanation:

If I don't write a long response then Brainly is going to attack me. Thank you for the points.

Which lines from the poem make up the actual “page” that the speaker writes for his instructor? How do they differ from the rest of the poem? Provide details from the text that support your response.

Answers

Answer:

read your book and you can under stand i

Someone please help me

Answers

Answer:

c) although.....

Explanation:

Which sentence is written correctly?


a
Eren Said, "I can't wait to be old enough to join the Scout Regiment".
b
Eren said, "i can't wait to be old enough to join the Scout Regiment."
c
Eren said, "I can't wait to be old enough to join the Scout Regiment."
d
Eren said "I can't wait to be old enough to join the Scout Regiment."

Answers

The answer is C.Eren said,

please answer what to look back i give you free 10 points if you answer this question ok ​

Answers

Answer

1:On top of the second floor

2:The beginning of a new day

3:Feel the heat of the shinning sun

Explanation:

Now this may not be correct,so don't rely on this answer.

1. new, second, two, shining, morning (i.e., the italicized words)

2. These words are adjectives (adjectives are descriptive words that describe a noun).

3. The words new, shining, and morning are different from second and two because they are describing qualitative qualities of their respective nouns, while second and two describe quantities (numbers).

Other Questions
The graph of a system of equations will intersect at exactly 1 point? PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT The corect phase sequence shownGas, Liguid, SolidLqud, Gas, SolidSold, Liguid, GasGas, Solid, Liquidabove i Which word comes from the Greek root meaning life A-boulevard B-BiologyC-bombardD-barometer Can Someone help me please Requiring children to be vaccinated before entering school is an example of what power? need help for civics What is the mass of 1.00 mol of oxygen (O2)? Cual Es el mejor programa esta ano A car is 180 inches long. A truck is 75% longer than the car. How long is the truck? How are ionic compounds named? Giving everything. Plzzz help. Which scientific term could be used in place of the word germ?a. bacteriologyb. pathogenc. hostd. replicate