Refer to the Newsela article “Can Eating Less Meat Cool the Climate?”

The author of the CON argument states that anti-meat groups want governments to discourage eating meat by levying taxes on it.

Which approach does the author of the PRO argument take to address this idea?


Eating less meat must be a part of an overall push for cleaner farming.

Becoming a vegetarian should be a personal choice that is not influenced by government.

The EPA has shown concern about the meat industry's handling of environmental issues.

Medical experts are in agreement that reducing meat consumption is good for overall health.

Answers

Answer 1

Answer:

C.

Explanation:

The EPA seems to be a reliable source that someone PRO argument could use as a fact to back their claims.


Related Questions

In the poem "White-Eyes,"what makes the poem take the shape of something falling? Check all that apply.

the different lengths of the lines
the way the stanzas are staggered on the page
the way the lines are staggered on the page
the description of the wind-bird in the tree
the comparison of winter to a white bird

Answers

Answer:

The way the lines are sttagered on the page

Explanation:

Answer:

1,2 and 3

Could possibly be wrong but I hope this helps

Which sentence is best structure to combine ideas of equal importance when they include a least one unequal element

Answers

Answer:

a

Explanation:

Answer:

C. When I was little, I loved trying all kinds of music, and my parents always encouraged me to develop my music talents

Explanation:

Hope This Helps <3

Hey,i have a question.Has anyone ever snuck candy or food from somewhere else into the movies?Im doing a project for school and i need some info.Thanks.:)

Answers

Answer:

Yes

Explanation:

I went to the movies with my Aunt. We had popcorn at home already so she popped some and put it in her purse. Movie candy is high so we went to a gas station and bought soda, candy, etc.

The trick is to bring a purse or a backpack. Purse is less suspicious though.

Tbh some movie theaters don't care.

Hope this helps!

Read this excerpt from We Beat the Street.


"Hassan and Ahi are going to Howard University in D.C.," Rameck commented, "but their folks have a little cash." He fell silent.


"I think it would be cool to go into business," Sampson said, "You know, become an entrepreneur and own some big company." He sounded a little vague.


"What kind of business is there around here except for drugs and crime?" George asked bitterly.


"Show business!" Rameck told him. "We can be rap stars!"


"Yeah, right. You need money even to do that," Sampson told him.


Sampson drove the other two home then, their hopes and dreams left in the starlight.


What effect does the boys’ lack of money have on them?


It makes them jealous of students who are going to college.

It fuels their interest in owning a successful business.

It motivates them to pursue their individual interests.

It makes them believe that their goals are too difficult to achieve.

Answers

D) It makes them believe that their goals are too difficult to achieve. Hope this helped. <3

pls answer soon thank you!

Answers

Answer:

soccer

Explanation:

soccer

Answer:

Graphics and headings.

Explanation:

need help
Read this excerpt from The Diary of Anne Frank.

Anne: (Pulling out a pasteboard-bound book) A diary! (She throws her arms around her father) I've never had a diary. And I've always longed for one. (She looks around the room) Pencil, pencil, pencil, pencil. (She starts down the stairs) I'm going down to the office to get a pencil.

Mr. Frank: Anne! No! (He goes after her, catching her by the arm and pulling her back.)

Anne: (Startled) But there's no one in the building now.

Mr. Frank: It doesn't matter. I don't want you ever to go beyond that door.

Anne: (Sobered) Never . . . ? Not even at nighttime, when everyone is gone? Or on Sundays? Can't I go down to listen to the radio?

Mr. Frank: Never. I am sorry, Anneke. It isn't safe. No, you must never go beyond that door.

Which statement best describes the conflict in the excerpt?

Anne is challenging her father’s authority.
Anne is finally facing the reality of a life in hiding.
Mr. Frank is punishing Anne for her reckless behavior.
Mr. Frank is criticizing Anne’s interest in keeping a diary.

Answers

B is the best answer
I think it is B because why not

Reread lines 25-40. What does this scene suggest is in Scrooge's future? *

A. Scrooge dies, and his servants don't know what to do next.
B. Scrooge is pretending to be dead, so he can trick his servants.
C. Scrooge dies, and his servants mourn his death.
D. Scrooge dies, and his servants strip his body and home of all valuables.

Answers

Answer:

D

Explanation:

I read the book and watched the movie.

d :) watched the movie and read the book. its a really good book ;)

Textual _____ can be defined as when you attempt to make sense of what you are reading by applying it to your own knowledge and experiences.
A. reading
B. analysis
C. exhibition
D. review

Answers

Answer:B

Explanation:analysis is the definition to structure something or along the lines of that so when your analyzing the text your using your knowledge too

B. Analysis. I believeeeee

pls answer soon thank you!

Answers

Answer:

Explanation:

It indicates many curves in the highway!

Answer:

A or D

Explanation:

the sign marks one of those

An allusion, such as “a Scrooge” is a reference to a well-known person, place, thing, event, or literary character. If you refer to someone as a Scrooge, you are implying that he is _____.


at the place where a person meets failure, from Napoleon’s battle at Waterloo

a romantic boy or man, from Shakespeare’s Romeo and Juliet

a stingy person, from Charles Dickens’ A Christmas Carol

Answers

Answer:

it's the character from A Christmas Carol

Answer:at the place where a person meets failure, from Napoleon’s battle at Waterloo

Read the excerpt from "Bone Detective," by Lorraine Jean Hopping.

The Hunley recovery team planned to display Diane’s casts in a museum that was about to be built. But did the casts belong in a public exhibit? Some people objected to displaying soldiers' remains—even though they were plastic replicas. Diane saw nothing wrong with it. In fact, she had no qualms about showing the real bones.

"If people want to really learn about the soldiers,” she said, "you have to show the bones. The bone is a record of a person’s life, especially the last part—the circumstances of death.”

How and why did the Hunley sink? What can we learn about the lives—and deaths—of its ill-fated crew? Scientists will likely be investigating the answers for years to come, thanks in part to Diane’s casts.

What is the author's viewpoint in this excerpt?

The author disagrees with Diane France and her decision to show the soldiers' bones at a museum.
The author appreciates Diane France for helping scientists by making casts of the soldiers' bones.
The author believes that Diane France should have done more to help the scientists understand the Hunley submarine.
The author hopes Diane will use her skills on military intelligence missions in the future.

Answers

Answer:

maybe its b or c

Explanation:

The answer is C. “The author believes that Diane France should have done more to help the scientists understand the Hunley submarine.” (Hope this helped! <3)

As you read the passage, highlight examples of direct characterization.

As Hannah told another joke, she pushed her curly red hair out of her eyes. She was a cheerful, silly girl, and she knew that Skylar liked her funny stories. Hannah took two apples out of her backpack and gave one to Skylar. Skylar bit into the apple.

Which words or phrases from the passage are examples of direct characterization? Check all that apply.

“curly red hair”
“cheerful”
“silly”
“took two apples”
“bit into the apple”

Answers

Answer:

Silly or cheerful

Explanation:

Her hair dosen't matter apples i don't think it matters

Answer: A (curly red hair)

Explanation:

Read this passage about seals and sea lions and then answer the question that follows:

From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.

In the passage about seals and sea lions, what is the purpose of the transition on the whole?

Answers

Answer:

To show comparison

Explanation:

-

Read the excerpt from Amy Lowell’s "Lilacs." What is the form of the poem?

Lilacs,
False blue,
White,
Purple,
Color of lilac,
You have forgotten your Eastern origin,
The veiled women with eyes like panthers,
The swollen, aggressive turbans of jeweled Pashas.
Now you are a very decent flower,
A reticent flower,
A curiously clear-cut, candid flower,
Standing beside clean doorways,
Friendly to a house-cat and a pair of spectacles,
Making poetry out of a bit of moonlight
And a hundred or two sharp blossoms.
Maine knows you,
Has for years and years;
New Hampshire knows you,
And Massachusetts
And Vermont.

A.
blank verse
B.
free verse
C.
lyric
D.
narrative
E.
descriptive

Answers

Answer:

B

Explanation:

Its a free verse poem because of the lack of conventions and the free flow

Answer:

descriptive

I hope this helps

more points
idk
(o-o)

Answers

Answer:

Explanation:

.........

Yes
I’ll take points
Thanks

which word best completes this analogy

Answers

Answer: C sorry if i am wrong if right plz mark brainliest god bless

Explanation:

Answer:

I will going with c ITS RIGHT

Explanation:

praying

its

right

according to the article "Outsmarted by an Octopus," how was an octopus able to make its tank overflow?

Answers

Answer:

The answer to your question should be A. The octopus stopped water from flowing out of the tank.

Explanation:

The octopus stopped water from flowing, I’m pretty sure it’s that one

According to Mr. Frank, how did Anne feel in the concentration camp in Holland?
afraid of the Nazi soldiers
fatigued from the hard labor duties
sad to be apart from Peter
happy to be outside once again

Answers

Answer:

fatigued from the hard labor duties

Explanation:

PLS HELP!!! I WILL GIVE THE FIRST GOOD ANSWER BRAINLIEST!!!!

Write three sentences describing your favorite movie. Use both transitive and intransitive verbs in your description.

Answers

I love the movie “the grinch” because every time I watch it , it makes me feel like it’s Christmas when it’s actually Halloween. :)

Answer:

star wars because it has interesting action scenes. It has a story line that makes me wonder what's next. At time it can get really interesting or action pumped while being a really balanced storyline of fantasy.

Explanation:

I NEED HELP PLZZZZZZZZZZ

Answers

Answer:

It would be D

Explanation:

Answer:

D

Explanation:

all the other people are doing one task after the other, while James is doing 2 at one time.

hope this helps!

I NEED SOMEONE TO ANSWER SOME QUESTIONS COMMENT IF YOU CAN ANSWER THEM !!!! FOR ELA ABOUT FLANNER O CONNER

Answers

Answer:

The answer is b

hope this helps

Explanation:

Answer:

B

Explanation:

Hope it helps, not much of an explanation for this one

Plzzz help
How do the changes you made to the stanza affect the setting and the character of the snark? Your answer should be 3-4 sentences.

Will report if you do it just for points

Answers

Answer:

Changes made on the stanza can affect the setting and the character of the poem through;

• Altering of the order of word causes a figurative meaning to words that do not have that. For example “ a sound sleep” differs from “a sleep sound”

• Changing stanza by placing words within a line in a planned order can create internal rhyme.

Write an objective summary of the article. Be sure to provide the overall central idea and three supporting details. Check your work for grammatical errors.


The book is,

Helping Hands: The Red Cross

By Alicia Garcia



pls dont steal my points like everyone else did its breaking my heart

Answers

Answer:

I cant find that book anywhere

Explanation:

Answer:  Helping Hands: The Red Cross is a brief history of the international Red Cross, an organization with millions of volunteers which strives to achieve peace and relief from suffering. In the article, Alicia Garcia, the writer describes the creation of the Red Cross in the aftermath of a 1859 battle during the Austro-Sardinian War. There, John Henri Dunnant led volunteers in caring for thousands of wounded soldiers, and later wrote a pamphlet that inspired a meeting to create "permanent societies of volunteers." Representatives met again 5 years later to formalize rules and functions for the Red Cross, and to urge their various countries to ratify the Geneva Convention.

The article goes on to explain how the Red Cross works today to provide relief services for victims of disasters, conduct blood drives, and in some countries, operate hospitals, train nurses, and provide ambulance services.

Another section tells how Clara Barton served the wounded on the battlefield during the Civil War and convinced people to establish the American Red Cross. The article concludes with a description of youth programs in which the Red Cross teaches elementary school students about safety, good health habits and courtesy. Through the Junior Red Cross they learn about nursing, first aid, life saving or disaster and relief training. There are numerous ways for Red Cross volunteers to lend their helping hands.  

Explanation:

.
What is a recurring theme?
a theme that doesn't make sense in a story
a theme that shows up again and again in different stories
a theme that no one has ever heard of before
a theme that seems to repeat itself throughout one story

Answers

Answer:

the answer is b

it comes up again and again, with little variation and similarity to many other stories

B it’s most likely to be B

What can you break, even if you never pick it up or touch it?

Answers

Answer:

"A Promise" can be break, even if we never pick it up or touch it.

Explanation:

It's invisable

Answer:

A heart

Explanation:

It can be broken easily... And it cannot be cured

Scenario Description
Miles is trying to learn how to play the banjo. They
Don't feel confident . They feel like giving up.

Activity: Write a letter of advice to your sixth-grade students to help them not give up.
The advice can be given in the form of a text message, email, social media post, or actual letter. It can also use pictures or cartoons, as well as words.

Include each of the following in your letter:
How the brain grows and gets stronger
What they can say to themselves to encourage a growth mindset
How to identify if their roadblock is internal or external
An If-Then Plan for their roadblock

Letter of Advice (Write below):
PLZ help and dont waste my points

Answers

Answer:

Explanation:

Hey Mile's I see you giving up on playing the banjo. Don't give up have a growth don't. If you don't succeed try try again practice makes better.

Answer:

Imagine if you got what you want, every time. No struggle. No hard work. No challenges. No hard work required.

Some of you are saying… that would be great… You would be weak!

And then, when something hard comes up in your life, you wouldn’t know how to handle it, because you have never gone through anything that strengthens you.

You can not GROW  without struggle. You can not develop STRENGTH without resistance, without challenging yourself, without struggle.

PAIN is your friend. Maybe not in the moment. But for the evolution of your soul, for the long term benefit of you as a stronger human being – pain IS YOUR FRIEND.

If you didn’t have failures… If you didn’t have struggles… If you didn’t have disappointment, you could have no strength, no courage, no compassion. How could you? Those qualities are MADE from your pain and struggle.

You were given pain because you are strong enough to handle it. You were given this LIFE because you are strong enough to live it. Because you are strong enough to drive though it. To THRIVE THROUGH IT. To inspire others through it.

They will look to you and say:

He did it,

She did it,

I have the strength to do it to.

You are stronger than you think. You’ve survived all your challenges to this point… And you will survive whatever is coming. But next time a struggle comes I don’t want you to curse the skies. Know that it was sent for a reason and a lesson. It might be to make you stronger, it might be to teach you patience, it might be for you to show others your spirit, there is a reason.

So don’t you give up. You have a purpose in this world. And you will only find it if you keep going and keep GROWING.

Explanation:

To reduce anxiety through deep breathing, it is important to

go through the steps five times.
turn on the computer.
end by getting comfortable.
inhale and exhale slowly.

Answers

Answer: Inhale and exhale slowly

Hope this helps!!

To reduce anxiety through deep breathing, it is important to inhale and exhale slowly. Thus, option (d) is correct.

What is sentence?

The term sentence is to define the proper meaning of, to clarify. The sentence is the completeness of to clarify the proper meaning. The grammatical arranged to the represent are the writing style. The language was to convey to the thoughts, ideas, and the share the preferences.

Stress and anxiety can be reduced with deep breathing. It's crucial to breathe deeply while gently inhaling and exhaling to lessen anxiousness. It was finishing the thought. A sensation of worry, dread, and unease is known as anxiety. You can start to perspire, become agitated and anxious, and experience rapid heartbeat. It can be a typical response to stress.

As a result, the significance of the completing the sentence are the aforementioned. Therefore, option (d) is correct.

Learn more about on sentence, here:

https://brainly.com/question/18728726

#SPJ3

What is President Roosevelt’s primary purpose in his speech?? A -To inspire listeners to lead lives of action and courage.
B - To describe a commonly accepted belief and show that it is misguided.
C - To attack his political opponents for being overly critical while accomplishing little.
D - To offer an objective, dispassionate take on human nature and the meaning of life

Answers

Answer:

A

Explanation:

He aims to instill hope and to inspire citizens to help aid the war efforts.

Answer:

A -To inspire listeners to lead lives of action and courage.

How does risk play a role in innovation?

Answers

Answer:What is the risk of innovation?

Given these two steps in the innovation process, the two key risks of innovation are: Failure to understand customers' needs. Failure to create a solution that effectively addresses well-understood customer needs.

Explanation:

what type of conflict goes on in the story Humpty Dumpty?

By type i mean like person vs. self which is internal conflict for example. Explain in detail.

Answers

person vs self i’m pretty sure
Other Questions
PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT The corect phase sequence shownGas, Liguid, SolidLqud, Gas, SolidSold, Liguid, GasGas, Solid, Liquidabove i Which word comes from the Greek root meaning life A-boulevard B-BiologyC-bombardD-barometer Can Someone help me please Requiring children to be vaccinated before entering school is an example of what power? need help for civics What is the mass of 1.00 mol of oxygen (O2)? Cual Es el mejor programa esta ano A car is 180 inches long. A truck is 75% longer than the car. How long is the truck? How are ionic compounds named? Giving everything. Plzzz help. Which scientific term could be used in place of the word germ?a. bacteriologyb. pathogenc. hostd. replicate Form a correct sentence by unscrambling the following jumbled words:El pueblo el en reino.El en el pueblo reino.El pueblo el reino en.El pueblo en el reino.Pueblo el en reino el.