Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Answers

Answer 1

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1


Related Questions

PLEASE PLEASE HELP ME QUICK.

The characteristics of certain cell divisions are described in the following table.

Characteristic Description
1 Forms diploid cells
2 Creates (INTERCOURSE) cells, or gametes

Which type(s) of cell division do the two characteristics represent?

A) Both characteristics represent meiosis.
B) Both characteristics represent mitosis.
C) Characteristic 1 represents meiosis and characteristic 2 represents mitosis.
D) Characteristic 1 represents mitosis and characteristic 2 represents meiosis.

Answers

The characteristics of certain cell divisions are described in the following table, the two characteristics represent is both characteristics represent mitosis.

What is mitosis easy definition?

Mitosis is a Method in which a single cell divides into two identical daughter cells (cell division).

In this cell divides once to form two identical cells. The major purpose of mitosis is for growth and to replace worn out cells.

So, option B is correct, Both characteristics represent mitosis.

(40 points) Give an example of an amino acid sequence using any 4 amino acids that you want.
add an explanation (please don't say DNA)

Answers

Explanation:

Methionine, valine, tryptophan, leucine, isoleucine, histidine, lysine, threonine and phenylalanine are examples of essential amino acids.

how mnay layers are in a earth

Answers

Answer: 244,970 lawyers in earth

Explanation: Have a noice day!

Answer:

just do your iob

Explanation:

Identify which scale is used to measure earthquakes?
The Saffir-Simpson Scale
The Fujiata Scale
The Richter Scale
The Earthquake Scale

Answers

Answer:

The Richter Scale

Explanation:

The Richter Scale is a scale developed by American seismologist Charles F. Richter to measure the magnitude of earthquakes. It is defined as the logarithm of the ratio of the amplitude of the seismic waves to an arbitrary, minor amplitude.

Why are the fossils of the mesosaurus species,that once lived together, found in different locations on earth now?

Answers

This divergent plate motion explains why the fossil remains of Mesosaurus that were once together are now found on continents thousands of kilometers apart.

Morse code is an alphabet or code in which letters are represented by combinations
of long and short signals of light or sound. Since there are only two possible values
and the letters are made from combinations of them, this is an example of:
a digital signal
an analog signal

Answers

Answer:

this would be an analog signal as is a constant movement of sound and light waves.

Explanation:

digital signal is more of measuring current and voltage in a circuit

no spams! only answrr if you know!! :)

Answers

Answer:

The answer may be B: Regeneration

Answer:

a. budding

Explanation:

Budding is a form of ase,xual reproduction that results from the outgrowth of a part of a cell or body region leading to a separation from the original organism into two individuals.

hope this helps:)

What does it mean for an organism to be anaerobic?

It is poisoned by oxygen.

It is poisoned by water.

It produces large amounts of oxygen.

It lives in salty environments.

Answers

it produces large amounts of oxygen

the graph below shows the growth of a field mouse population in an ecosystem over time the dash line indicated the carrying capacity for the last population is correctly shown on which graph​

Answers

The first graph is correct. The population rises above then below the carrying capacity repeatedly. When the population rises above the carrying capacity, the population can no longer be supported and so it will decrease. When the population decreases below the carrying capacity, there will be more available resources so the population can grow.

The graph below illustrates the development of a field mouse population through time in an environment. The population's carrying capacity is shown by the dashed line.

What is the depiction with the letter B ?

The graph with the letter B appropriately displays the population's carrying capacity. The dashed line indicates the carrying capacity. The graph shows the number of field mice increasing gradually over time until it is reached.

Once the population has stabilised, it stays within the carrying capacity. Given that the ecosystem's population is constrained by the resources available to it, this behaviour is predicted. The carrying capacity for the population is not correctly depicted in the other graphs. Population growth is depicted in Graph A exponentially, which is unreal.

In Graph C, the population is shown to increase continuously until it exceeds the carrying capacity, which is also unreal. The population is declining with time in Graph D, which is not consistent with a steady population. In conclusion, only Graph B correctly depicts the carrying capacity for the field mouse population.

The carrying capacity, shown by the dashed line, is reached when the population continues to expand at a steady rate. Once the population has stabilised, it stays within the carrying capacity. This behavior is to be expected in an ecosystem, as the population is limited by the resources available in the environment.

Learn more about  environment at:

https://brainly.com/question/30821114

#SPJ2

How is Contribution Margin Dollars Calculated​

Answers

[tex]\huge\purple{Hi!}[/tex]

Contribution Margin Dollars is Calculated by The contribution margin is computed as the selling price per unit, minus the variable cost per unit.

Why do plants contain the
greatest amount of energy in the
food pyramid?

Answers

Answer:

According to the pyramid of energy, the energy content is maximum in autotrophs or producers. Autotrophs are the plants which prepare their food by photosynthesis. They are the primary producers and primary source of food energy. The flow of energy is unidirectional from producer to consumer level.

Explanation:

According to the energy pyramid, autotrophs or producers have the highest energy content. Autotrophs are plants that prepare their nourishment through photosynthesis. They are the key producers and energy sources for food. Energy flows unidirectionally from producer to consumer.

What is an Energy pyramid?

A trophic pyramid, also known as an ecological pyramid, is an illustration of the flow of nutrients through an ecosystem. It is a graphical representation of the proportions of energy available in an ecosystem at each trophic level, or feeding level.

The pyramid of energy is often divided into tiers, with primary producers, like power plants, at the bottom. Above the primary producers come the principal consumers, which include herbivores that eat plants. Then there are secondary consumers, like carnivores that eat herbivores, and so on.

Thus, according to the energy pyramid, autotrophs or producers have the highest energy content.

Learn more about Energy pyramid, here:

https://brainly.com/question/2515928

#SPJ2

When the spine curves inward at the low back this is referred to as

Answers

Answer: Lordosis

Explanation:

Lordosis is the answer^
|

True or false human beings have 46 chromosomes in every cell

Answers

Answer:

True

Explanation:

In humans, each cell normally contains 23 pairs of chromosomes, for a total of 46.

Construct an argument about how the physical and biological components in the Chesapeake Bay ecosystem affect the crab populations and other fisheries over time. In your response be sure to:

Identify factors that affect the survival and reproduction of organisms.
Describe specific examples of cause-and-effect relationships between changes in the physical or biological components of the ecosystem and the populations of crabs and fish.
Explain how small changes in one component of an ecosystem can cause large changes in another component.
Use appropriate evidence and scientific reasoning.

Answers

To make an argument about how environmental imbalance affects the ecosystem of the Chesapeake Bay, research on reliable sources on the topic is necessary.

How is the Chesapeake Bay?

The bay corresponds to the largest ecosystem of estuaries in the USA, being a source of diverse types of habitat for wildlife, with more than 3,600 species of animals and plants.

An example of the environmental imbalance in the area is the commercial and recreational fishing of blue crab, whose population had a significant reduction in 2022.

Therefore, environmental factors and human exploration are responsible for generating such an imbalance, and the development of policies and actions to promote sustainability is essential.

Find out more about sustainability here:

https://brainly.com/question/25713190

#SPJ1

When there is a lack of resources such as food, water, sunlight, shelter, and space this is often called
O carrying capacity
O messy
O limiting factors
O found in rocks

Answers

Answer:

Limiting factors

Explanation:

Answer:

limiting factors

Explanation:

since the resources mentioned are insufficient it means that those resources are limited

In the late 1800s, more women
were able to enter the workforce
due to the need for what?

Answers

The addition of women in the work force was one of the main factors that has increased social mobility over the last 50 years, and to help the women to support their families

(Hope this helped?)

Answer: Typists

Explanation: I hope this helps you

Which is an example of minutiae in the study of fingerprints?

options:

loop

termination

arch

whorl

Answers

Answer:

bridge,for,and eye or enclosure

What is the growth rate of a population in a habitat that has reached carrying capacity? Explain your answer.

Answers

It can be saying of logistic population growth occurs when the growth rate of decreases as the population reaches the carrying capacity. The carrying capacity is the maximum number of individuals in a population that the environment can support. It can also say a population exceeds carrying capacity, the ecosystem may become unsuitable for the species to survive.

The equation shows cellular respiration. During cellular respiration, glucose combines with oxygen to form carbon dioxide, water, and ATP.
uppercase C 6 uppercase H 12 uppercase O 6 + 6 uppercase O 2 right-arrow 6 uppercase C uppercase 0 2 + 6 uppercase H 2 uppercase 0 + A T P
What happens to the energy in the bonds in glucose?

Answers

The energy in the bonds in glucose gets transferred to ATP.

What is Cellular respiration?

Cellular respiration may be defined as the process by which organisms incorporate oxygen with foodstuff molecules, pivoting the chemical energy in these substances as waste products, carbon dioxide, and water.

The complete question is as follows:

The energy is transferred to oxygen. The energy is transferred to carbon dioxide. The energy is transferred to the water. The energy is transferred to ATP.

Cellular respiration involves the transformation of energy from glucose to the formation of ATP via ADP. ATP operates as the major energy molecule and is required by nearly every cell to carry out its normal functions.

Therefore, the correct option for this question is D, ie. The energy is transferred to ATP.

To learn more about Cellular respiration, refer to the link:

https://brainly.com/question/2809259

#SPJ1

Differences between the chromosphere and corona of the sun

Answers

Corona is the outermost layer whereas chromosphere is the transparent layer of the sun.

What is the differences between the chromosphere and corona of the sun?

Corona is the outermost, hot shell of the atmosphere of the sun while on the other hand, the chromosphere is a transparent layer present between the corona and the photosphere.

So we can conclude that Corona is the outermost layer whereas chromosphere is the transparent layer of the sun.

Learn more about sun here: https://brainly.com/question/15837114

#SPJ1

Answer:

I is a low density layer which is about 2,000km thick. It is called chromosphere because it has a red to pink colour. It is normally only visible during a solar eclipse. The corona is plasma surrounding the Sun which extends hundreds of kilometers from the surface of the Sun.

Which would be an example of disruptive natural selection?

A.The presence of more light-colored moths in rural areas and to more dark colored moths in industrial areas but FEWER medium-colored moths in either location


B.A new predator feed on small-sized fish, leading to an increase in the large fish population


C.Human babies with average birth weight are more likely to survive than a baby that is either too small or too heavy

Answers

An example of disruptive natural selection is the presence of more light-colored moths in rural areas and to more dark-colored moths in industrial areas but FEWER medium-colored moths in either location. Thus, the correct option is A.

What do you mean by Natural selection?

Natural selection may be defined as the approach through which populations of living organisms acclimate and change.

Disruptive natural selection occurs when environmental conditions changes in two different ways or in two different locations.

Therefore, the correct option for this question is A.

To learn more about Natural selection, refer to the link:

https://brainly.com/question/14385908

#SPJ1

On a victim, a clean, circular entrance wound is found. Which most likely caused this wound?
options:

a pistol fired at a close range

a shotgun fired from close range

a rifle fired from a distance

a shotgun fired from a distance

Answers

Answer:

A pistol fired at a close range

Explanation:

Because a shotgun would be more messy, and a rifle would probably also be just as messy because of the higher caliber.

On a victim, a clean, circular entrance wound is found.  The wound is because of the a pistol fired at a close range which clearly shows that the gun distance is closer.

What should be the first thing done in this case ?

In this case, the first thing should be done to call the doctor, call the ambulance and inform the police.

When the wound is clearly circular and no other patterns of wounds such that the messy structure is formed then in this case the pistol distance would have been closer.

A rifle firing distance would have made the deep and the situation shows that there is no superficial wounds such that the structure is clearly circular and in this case from almost all the observations it is demonstrated that a pistol fired at a close range.

Learn more about pistol gun wounds at :

https://brainly.com/question/11953490

#SPJ2

A point of view influenced by opinion is know as?

Answers

Answer:

The question is to state the term that described the point of view influenced by opinion and based on my research and further analysis, I would say that the answer would be a Minority Influence. It is a  form of social influence, that takes place when a member of a minority group influences the majority.

Answer:

The question is to state the term that described the point of view influenced by opinion and based on my research and further analysis, I would say that the answer would be a Minority Influence. It is a  form of social influence, that takes place when a member of a minority group influences the majority.

Explanation:

Discuss the similarities and differences between the seeds’ vaults.

Answers

Answer:

Svalbard is a kind of insurance policy for other gene banks. Plant breeders and researchers depend on seed banks around the world to obtain varieties with useful traits that they need. If those seed banks later lose their own resources, because of natural or man-made disaster, the collections could be restored by getting the copies back from svalbard.

Explanation:

Amnesia is a physical disorder that affects the brain. Which statement best explains why amnesia may also be considered a psychological disorder?
it can affect personality
it reduces brain function
it can be caused by trauma
it interferes with motor skills

Answers

Answer:

it can affect personality

Explanation:

A psychological disorder is an ongoing dysfunctional pattern of thought, emotion, and behaviour that causes significant distress, and that is considered deviant in that person's culture or society

Answer:

it can be caused by trauma

Support irnas claim,using two pieces of evidence from the scientists experiment,figures 1 through 7, and both tables. Explain why each piece of evidence supports your claim

Answers

Irina's claim is not found here but evidence from an experiment might include the amount of a product (chemical) or the order of nucleotides (biological evidence).

What is scientific evidence?

Scientific evidence refers to the observations that can be used to support (or reject) a working hypothesis.

Scientific evidence is variable depending on the field but it is always collected by observational or experimental procedures.

In conclusion, Irina's claim is not found here but evidence from an experiment might include the amount of a product (chemical evidence) or the order of nucleotides (biological evidence).

Learn more about scientific evidence here:

https://brainly.com/question/507522

#SPJ1

Dietary fats, specifically cholesterol, have been given a bad image in the popular media; however, they are essential for energy storage and for use in building new cells. If dietary fats were removed entirely, what portion(s) of the cell would be most affected and why?

Answers

Dietary fats are necessary for providing energy to your body and supporting cell activity. They also aid in the protection of your organs and the preservation of your body's heat. Fats aid in the absorption of certain nutrients and the production of key hormones.

What is cholesterol?

Cholesterol is a waxy, fat-like molecule found in all of your body's cells. Cholesterol is required by your body for the production of hormones, vitamin D, and chemicals that aid digestion. Your body produces all of the cholesterol that it requires.

Fatty acids provide an ideal anisotropic solution for other membrane constituents due to their existence in bilayer membranes. They give the membrane bilayer fluidity, allowing membrane-bound receptors, enzymes, and other proteins to diffuse laterally along the bilayer membrane's surface.

For more information regarding Cholesterol, visit:

https://brainly.com/question/1260520

#SPJ1


Think about the two words that make up the term reproductive isolation. How do you think reproductive isolation affects the evolution of a species?

Answers

The isolation barriers prevents two of the species to mate, resulting in them evolving into different species

Question is the picture
7th grade science!

Answers

It’s the third one because if an organism dies off because it’s not evolved to match an environment that’s natural selection

What is cell division?

Answers

Answer:

a picture of a cell division

cell division happens when parent cells divides into 2 or more cells called daughter cells. cell division usually occurs as part of a large cycle.

Other Questions
Which of the following CAN NOT be considered a single phase?a) a pure liquidb) a heterogeneous mixturec) a homogeneous mixtured( a pure solid In the diagram below, what part of the excretory system is labeled C? A. Bladder B. Kidney C. Urethra D. Ureter Aarons mother purchases a new computer for $1750. If she claims a linear depreciation (loss of value) on the computer at a rate of $250 per year, how long will it take for the value of the computer to be $0? please help me im just really slow Use the bar graph to find the experimental probability of the event.The experimental probability of spinning a 7 is which equation has an infinite amount of solutions The brick will be painted. Which measure will help the painter know how much paint to buy? Please help me this is my last question this one is worth big points for me (2x4 +7) + (5x4 - 4)simpfly Complete the slope-intercept form of the linear equation that represents the relationship in the table please help me 50 points bad answers will get reported caffeine even3. Marina, the beautiful mermaid, wanted some tuna salad. But had a small problem since she was allergic to celery. At Sammy's Sub Shop, Marina hoped to find tuna salad free of this dangerous vegetable.Hopping across the tiled floor to the counter Marina placed her order and then checked her sandwich for celery. Not noticing, however, the spoiled mayonnaise. At five o'clock that evening, Marina becameviolently ill with food poisoning. When a lifeguard at the beach discovered the problem, he called 911. Even though the mermaid had fishy breath. A handsome paramedic gave her mouth-to-mouth resuscitation.Wailing like a sick dog, the ambulance sped off to the hospital. Where the doctor on call refused to treat a sea creature with a scaly tail. A kind nurse, however, had more sympathy. When this caregiver returnedwith a liquid antacid. Marina drank the entire bottle, feeling an immediate improvement. The mermaid told the rude doctor never to swim in the ocean. For she would order hungry sharks to bite off the doctor'slegs. While sharp-clawed crabs plucked out his eyes. Tossing her long hair, Marina thanked the nurse for the antacid. And took a mint from David, the handsome paramedic.SentenceFragment Anita's grandmother is passing on her family history. Identify each skill she orAnita is using in each example belowi. Anita's grandmother tells about her family's journey to America.ii. Anita's grandmother shares words that her own mother usedili. Anita's grandmother agrees to share more stories, and Anita makes arecording of her telling them.iv. Anita asks her grandmother, "What was farming like in the old country?x Anita asks more questions about farming. Phyllis invested 800 dollars into two different accounts, a portion earning a yearly interest rate of 4 percent per year compounded monthly and the rest earning a rate of 6 percent per year compounded quarterlyAfter 12 years the investments were worth $1579.05. How much money did she invest at each rate What is the sum of the polynomials? (x2 9) (3x2 11x 4) If f(x) = 3x -1 and g(x) = x+2, find (f + g)(x). A young woman in her first trimester of pregnancy goes to her doctor after experiencing heavy bleeding. After examining the woman and finding that she has miscarried, the doctor states that she has had a spontaneous abortion. The young woman becomes very upset because her family believes that abortion is a sin.Explain the breakdown in communication that has occurred and how it could be corrected. 1. Read each question carefully. Write the letter of the correct answer in you paper. 1. Which of this is made up of smallest particles of rocks which contain decayed matter of plants and animals? A. Land B. Soil C. Mineral D. Water 2. How many types of soil are there? A. 2 B. 1 C. 3 D. 4 3. Which soil holds much water? ABU A. Loam B. Clay C. Sand D. silt I-19 4. Why is soil important to living things? Because it 3 A. forms part of the earth where animals live. B. provides the necessary nutrients needed by plants. C. serves as a place where people live. D. all of the above. 5. Which of the soil type is good for making pots? A. Clay B. Loam C. Soil D. silt 6. How does decayed organism like plants and animals make soil fertile? A. change its color C. makes the texture finer B. enhances color D. add nutrients to the soil 7. What type of soil do you usually expect in a shoreline? A. Clay B. Loam C. Sand D. A and C 8. In which layer of the soil do we usually find loam? A. Topsoil C. Bedrock B. Parent soil D. Ground soil Fill in th Read the passage from "The Caged Bird.The free bird thinks of another breezeand the trade winds soft through the sighing treesand the fat worms waiting on a dawn bright lawnand he names the sky his ownWhat are the connotative meanings of sighing, as used in the poem? Choose two answers.longingsadnessrelaxationexhalingpeacefulnessbreathing In a data set, the proportion of items that are in a particular category is called the.