Irina's claim is not found here but evidence from an experiment might include the amount of a product (chemical) or the order of nucleotides (biological evidence).
What is scientific evidence?Scientific evidence refers to the observations that can be used to support (or reject) a working hypothesis.
Scientific evidence is variable depending on the field but it is always collected by observational or experimental procedures.
In conclusion, Irina's claim is not found here but evidence from an experiment might include the amount of a product (chemical evidence) or the order of nucleotides (biological evidence).
Learn more about scientific evidence here:
https://brainly.com/question/507522
#SPJ1
Sebastian wants to make ball-and-stick models of the four macromolecules. He has colored balls for each of the elements in these molecules, including the following.
red: hydrogen
black: carbon
purple: oxygen
green: nitrogen
Which molecule could he make that consists of long chains of red and black colored balls?
carbohydrates
lipids
nucleic acids
proteins
Macromolecules are defined as large molecules like lipids, proteins, and carbohydrates.
In the given data, the red colour denotes hydrogen and black denotes carbon. The molecule that needs the majority of red and black color is carbohydrates. Thus, option "A" is correct.
What are Carbohydrates?Carbohydrates can be explained as:
Carbohydrates are the macromolecules, generally referred to as sugar. Carbohydrates are the primary nutrients of the diet along with proteins and fats.
Carbohydrate is a biomolecule that is made up of carbon, hydrogen, and oxygen atoms. The monomeric units of carbohydrates are monosaccharides.
Thus, the correct answer is Option A.
To know more about carbohydrates, refer to the following link:
brainly.com/question/16987478
#SPJ1
Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?
The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.
What is Taxonomic classification system?This is defined as the classification of organisms based on shared characteristics.
This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.
The complete question is:
Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.
Which of the following best explains why a standardized classification system is important to the scientific community?
Read more about Taxonomic classification system here https://brainly.com/question/11724129
#SPJ1
Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation
I'll give brainly to whoever response is good !
please help me :C
Answer:
At the beginning of the follicular phase, the lining of the uterus (endometrium) is thick with fluids and nutrients designed to nourish an embryo. If no egg has been fertilized, estrogen and progesterone levels are low. As a result, the top layers of the endometrium are shed, and menstrual bleeding occurs.
You are provided with three liquids - Water, honey and oil. On pouring the three liquids simultaneously without disturbing. What will be the arrangement of these liquids from top to bottom and why? Conduct this experiment at home and paste the picture of it with proper labeling
Answer:
Honey would be on the bottom, water in the middle, and oil on the top.
Explanation:
Honey is on the bottom because it has a is greater density than water, and oil is on the top because it has less density than water.
It all depends on the viscosity of the materials. Honey on the bottom, oil floating on top and in the middle is water.
What kind of liquids float on water ?The liquids which are in lesser weight just floats over the surface of water.
In the attached image it can be seen clearly that the denser of all is honey which has the property of viscosity as well and it just settles down on the surface whereas the lighter of all is the oil which is seen floating on the surface.
Oil and Water is usually the most common type of example of the two types of immiscible liquids. In this no matter what quantity you mix the oil and water in that they do not mix up . The reason why this happens is as of the basic chemical nature of the oil and the water molecules.
Learn more about miscible liquids at :
https://brainly.com/question/2193479
#SPJ2
How might compound leaves and leaves with lobed margins be well-suited to windy environments?
Compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.
What is a plant adaptation?A plant adaptation is any type of trait that confers an evolutionary advantage in a given environment.
Plant adaptations include, for example, the presence of fewer stomata in leaves in plants living in arid conditions.
In conclusion, compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.
Learn more about plant adaptations here:
https://brainly.com/question/29594
#SPJ1
The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic. Which is which
another name for the cell, or plasma, membrane
Another name for the cell membrane or plasma membrane can be Plasmalemma (it is uncommon).
What is the plasma membrane?The plasma membrane is a physical barrier that separates the cell from its surrounding environment.
This barrier (plasma membrane) is fundamental to maintain the internal homeostasis state of the cell.
In conclusion, another name for the cell membrane or plasma membrane can be Plasmalemma (it is uncommon).
Learn more about the plasma membrane here:
https://brainly.com/question/734740
#SPJ1
choose the correct answer
number 2
number 2 because the colour doesnt matter
Which ,begin emphasis,two,end emphasis, statements describe how constantly changing conditions affect the overall population size of organisms living in the area?
The correct options would be B and E.
Variation in population sizeThe population size of each organism in different zones may not vary much due to the following:
Organisms in each zone have characteristics that make them be well-adapted to the zone. These include structures that help them attach to the rock, structures that help them breathe when exposed to the air, and so on.More on adaptations of organisms can be found here: https://brainly.com/question/1686177
#SPJ1
The backbone is also known as the vertebral column. Justify in accordance with both the
terms used
An organism that is eaten by a predator is
Prey is a term given to the organism that is eaten by the predators.
10 points!
A fungal ____________ is a haploid reproductive cell that is capable of developing into a new organism.
Answer:
it’s a spore
Explanation:
it should be a spore. It’s because the spore is the haploid.
You are taking conductivity and salinity measurement in an estuary every half hour over a tidal cycle. Explain what a graph over time would look like for an upper estuary site where farmers use the water for irrigation and a lower estuary site where there is a bream and flathead fishing industry.
A graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.
What are salinity and conductivity measurements?Salinity is a measure of the salt content of a water body.
Conductivity is a measure of the electrical conductivity of a solution or substance.
Conductivity increases with increase in salinity.
An estuary is a region where salt water from the sea meet freshwater from a river or stream.
At an upper estuary site where farmers use the water for irrigation, there will be decreased salinity and conductivity with time, while at a lower estuary site where there is a bream and flathead fishing industry, their will be increased salinity and conductivity with time.
Therefore, a graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.
Learn more about salinity and conductivity at: https://brainly.com/question/2472580
#SPJ1
Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factors in their work that could increase their chances of cancer?
This is the complete question.
Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factor
in their work that could increase their chances of cancer?
A. Scientists who work with toxic chemicals
B.therapist who operate radiation machine
C.nurses who treat patients with viral infections
D.researches who study DNA replication
Research that study DNA replication. Thus, option "D" is correct.
What is cancer?Cancer directs to any one of a considerable number of diseases described by the growth of anomalous cells that separate uncontrollably and have the ability to enter and destroy ordinary body tissue.
Cancer often has the ability to spread throughout your body. Cancer is the second-main cause of dying in the world.
Thus, option "D" is correct.
To learn more about Cancer click here:
https://brainly.com/question/8590464
#SPJ1
What is meant by solar energy?
Answer: Solar energy is the radiation from the Sun capable of producing heat, causing chemical reactions, or generating electricity.
Explanation:
Answer:
Renewable energy produced by the sun. It is carbon neutral but unreliable.
For a long time, penicillin was given to people to kill the bacteria which caused ear infections. Lately, some ear infections are not cured by penicillin. Which is the best explanation for this?
Answer:
Some bacteria have mutated and are not killed by the penicillin
Explanation:
Wild salmon spend most of their lives in the ocean but return to freshwater rivers to spawn, or reproduce. Most wild salmon will only spawn in specific spawning grounds in the rivers in which they were born. The construction of hydroelectric dams in rivers has blocked the paths of some salmon returning to their spawning grounds. This has led to population declines. Which method would be most effective in preventing further wild salmon population declines caused by the construction of hydroelectric dams?
A.
establishing protected regions around wild salmon spawning grounds in specific rivers
B.
observing the migration patterns of wild salmon by tagging and tracking a small sample of fish
C.
monitoring genetic diversity by using netting to catch salmon and obtain genetic samples
D.
constructing passageways next to dams to allow salmon to swim around blocked rivers
Constructing passageways near the dams to allow to salmon to swim around blocked rivers. Thus, option "D" is correct.
How, explain your answer briefly?The construction of dams in rivers has blocked the path of some salmons returning to spawning grounds.
The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.
Thus, option "D" is correct.
To learn more about salmons click here:
https://brainly.com/question/16208604
#SPJ1
how can global warming lead to changes to the Earth's surface?
Answer:
It could lead to the changes in the earths surface because it could open up geysers in the crater, causing the earths surface to change.
One possible reason for the rise in the average air temperature at the Earth's surface is that
Answer:
cimate change
We can mold metals into different shapes because they are _____________.
ductile
malleable
lustrous
Answer:
We can mold metals into different shapes because they are _malleable__.
Explanation:
Malleable (ability to be hammered into thin sheets)
Which feature of the ocean floor includes its deepest parts?
Thad rolls his bowling ball down the lane with a
force of 63 Newtons. If his ball has a mass of 7 kg,
what is the resulting acceleration of the ball?
35.
The acceleration of the ball is, 9m/s.
How, explain your answer briefly?Given data:
The mass of the bowling ball is, m = 7 kg.
The magnitude of force offered by ball is, F = 63 N.
The above problem is based on the Newton's second law of motion. According to the Newton's Second law of motion, the applied force is equal to the product of mass and acceleration of the body.
So,
F = ma
Solving as,
a = F/m
a = 63/7
Thus, we can conclude that the acceleration of the ball is, 9m/s.
Learn more about Newton's second law here:
brainly.com/question/13447525
#SPJ1
Which of the following is a natural resource for humans?
A-Cars
B-Electricity
C-Houses
D-Wood
Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.
Answer:
B.) Can lead to new species that share common ancestors
Explanation:
Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).
. Which describes the function of the cell cycle in such single-celled organisms?
reproduction
repair
growth
protection
What is the relationship between population and demand for resources?
equal
There is no relationship.
inversely proportional
directly proportional
Which of the following best explains how monkey is able to exchange gases with its environment and deliver oxygen throughout its body?
The ability of a monkey to be able to exchange gases with its environment and deliver oxygen throughout its body is through the activities of the respiratory system.
What is respiratory system?The respiratory system is defined as one of the body systems that are made up of a network of tissues and organs that aid in the exchange of carbon dioxide and oxygen.
The oxygen passes from the environment into the nostrils. It is then conveyed by the trachea to the bronchi and arrives at the alveoli where the oxygen is delivered to the body cells.
Therefore, the ability of a monkey to be able to exchange gases with its environment and deliver oxygen throughout its body is through the activities of the respiratory system.
Learn more about respiration here:
https://brainly.com/question/18169685
#SPJ1
Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent
the correct answer is detergent which is not approved
The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.
What is a hand sanitizer?Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.
Detergents are not approved during the formation of hand sanitizer.
Thus, the correct option for the given scenario is D.
For more details regarding sanitization, visit:
https://brainly.com/question/4296165
#SPJ2
Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA
In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
What are restriction enzymes?Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).
These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.
In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
Learn more about restriction enzymes here:
https://brainly.com/question/15278286
#SPJ1
Describe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease
Answer:
escribe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease
Explanation: