the law of states that genes have alternative forms, or alleles. in a organism, the two alleles of a gene separate during and gamete formation; each sperm or egg carries only one allele of each pair. this law explains the ratio of the f2 phenotypes observed when self-pollinate. each organism inherits one allele for each gene from each parent. in individuals, the two alleles are different, and expression of the allele masks the phenotypic effect of the allele. in individuals, the two alleles are identical.target 1 of 12 target 2 of 12 target 3 of 12target 4 of 12target 5 of 12target 6 of 12target 7 of 12target 8 of 12target 9 of 12 the law of states that the pair of alleles for a given gene segregates into gametes independently of the pair of alleles for any other gene. this law explains the ratio of the f2 phenotypes in a cross between .

Answers

Answer 1

The law of Segregation states that genes have alternative forms, or alleles. In an organism, the two alleles of a gene separate during and gamete formation; each sperm or egg carries only one allele of each pair. this law explains the ratio of the f2 phenotypes observed  monohybrids self-pollinate.

Each organism inherits one allele for each gene from each parent. In heterozygotes, the two alleles are different: expression of the dominant allele masks the phenotypic effect of the recessive allele. Homozygotes have identical alleles of a given gene and are true-breeding.

The law of independent assortment states that the pair of alleles for a given gene segregates into gametes independently of the pair of alleles for any other gene. In a cross between dihybrids (individuals heterozygous for two genes), the offspring have four phenotypes in a 9:3:3:1 ratio.

What are phenotypes?

The phenotype is described as the set of observable characteristics or traits of an organism which covers the organism's morphology or physical form and structure, its developmental processes, its biochemical and physiological properties, its behavior, and the products of behavior.

In conclusion, Gregor Mendel formulated a theory of inheritance based on experiments with garden peas. During the experiment, he proposed that parents pass on to their offspring discrete genes that retain their identity through generations. This theory includes two “laws that was described above.

Learn more about Gregor mendel at: https://brainly.com/question/930312

#SPJ1


Related Questions

Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.

Answers

A. He crossed true-breeding pea plants

The research practices Mendel used is applies including A, B and C.

What is Mendel's experiment?

Mendel studied inheritance in peas (Pisum sativum). He chose peas because pea plant are easy to grow and can be sown each year. Pea flowers contain both male and female parts, called stamen and stigma, and can usually self-pollinate.

Mendel studied the inheritance of 7 traits in pea plants including height, flower color, seed color, and seed shape and each trait had 2 forms. He identified pure-breeding pea plants that consistently showed 1 form of a trait after generations of self-pollination.

Mendel proposed a theory of inheritance, based upon the observed data during his experiments, and a mathematical analysis of his results,

Thus, from above, the correct options include A, B and C whereas D doesnt apply because Mendel studied 7 traits at a time.

Learn more about Mendel' experiment, here; https://brainly.com/question/3056662

#SPJ2

what does the tilde symbol mean in biology

Answers

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".

How do invasive species usually affect the availability of natural resources in an ecosystem?

PLEASE HELP ME​

Answers

Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

Explanation:

Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree

Answers

Answer:

D

Explanation:

The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria

I think it’s a calibrator but I’m not 100% sure he might be right it could be D

In the digestive system, what part of the body precedes the large intestine?
O A. Esophagus
OB. Stomach
O C. Small intestine
O D. Mouth

Answers

In the digestive system, small intestine of the body precedes the large intestine. Therefore, option (C) is correct.

What is small intestine?

The small intestine is a long, narrow tube-like organ that is part of the digestive system in humans and other animals. It is located in the abdominal cavity between the stomach and the large intestine, and is approximately 6 meters (20 feet) long in adult humans.

The primary function of the small intestine is to digest and absorb nutrients from food. It accomplishes this through the action of enzymes and other digestive secretions produced by the pancreas and liver, as well as through the action of tiny finger-like projections called villi and microvilli that line the intestinal walls. These structures increase the surface area of the small intestine, allowing for efficient absorption of nutrients into the bloodstream.

The small intestine plays a critical role in maintaining overall health and well-being by ensuring that the body receives the necessary nutrients to support its various functions.

Learn more about small intestine, here:

https://brainly.com/question/1751875

#SPJ7

helpppp I’ll do anything BUT I HATE links so please NO links

Answers

Mitochondria: supplies energy to the cell

Nucleus: Control center of the cell; contains DNA

Ribosomes: makes proteins inside cell

Cell membrane: protective layer of the cell

Hope this helps :)

Mitochondria: source of energy to cell

Nucleus: contains dna and controls center

Ribosomes: produces protein

Cell membrane: gives protection

Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.

Answers

Answer:

Liver phosphorylase a concentration decreases when glucose enters the blood.

The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form

As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form

Explanation:

Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.  

Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver​

Answers

Answer:

The pancreas

Explanation:

it happens when the pancreas doesnt produce enough of something called insulin

which role do plants play in the nitrogen cycle?

Answers

Answer:

C .they take up the usable forms of nitrogen found in the soil .

Explanation:

What features of eukaryotes provide additional opportunities for the regulation of gene expression compared to bacteria? Select all that apply. Select all that apply. interaction with external environment transcription and translation are coupled processes separated processes of transcription and translation presence of chromatin opportunity for posttranscriptional and pre-translational regulation activation of all genes in genome

Answers

Answer:

separated processes of transcription and translation presence of chromatin opportunity for posttranscriptional and pre-translational regulation

Explanation:

Since there is no nucleus surrounding the genetic material in prokaryote cells, the transcription and translation processes occur simultaneously. Transcription stops when a protein is not necessary. So the control of protein synthesis is regulated by transcription and not translation. Once the transcription is on, all the following steps must follow it.

Transcription is the process that controls the genic expression in bacteria.

Eukaryotes do possess a nuclear membrane that separates the genetic material from the rest of the cell. The transcription process occurs inside the nucleus membrane, while the translation process occurs outside. In the cytoplasm occur the translation process and protein synthesis. Genic regulation can happen in any of these processes in different regions of the cells.

In eukaryotes, the regulation of the genic expression control might happen at different levels:

Epigenetic level: When DNA molecules open and nucleosomes separate to join the transcriptional factorsTranscription level: When the messenger RNA is being transcriptedPost-transcription level: When mRNA goes to the cytoplasm Translation level: During the protein elongationPost-translation level: Once the protein synthesis is over.  

How can a small mutation provide a small advantage to an organism?

Answers

Answer:

It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.

Hope this helps!

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

I need help ASAP!!
A.D
B.B
C.C
D.A

Answers

Answer:

a ibecause tifmsndtbeekodfhekekn

Which of the following fresh water biomes consists of moving water

Answers

Answer:

Biomes consists of moving water is estuaries.

Both Mrs. Smith and Mrs. Jones had babies the same day in the same hospital. Mrs. Smith took home a baby girl named Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect, however, that her baby had been accidently been switched with the Smith baby in the nursery. Blood tests were made. Mr. Smith was blood type A, Mrs. Smith was type B, Mr. Jones was type A, Mrs. Jones was type A. Shirley was type O, and Jane was type B. Had a mix-up occurred? SHOW WORK!

Answers

Answer:

yes a mixup had occured because two A blood types would result in a baby with the same blood unle mr.jones wasnt the father

Explanation:


Please help, A, B,C, or D?

Answers

Answer:

I cant see the pic??

Explanation:

What is the formula to find out the energy when given the energy?

Answers

2
KE=0.5×m×v
2
I think

What is the major distinction scientists use to divide the animal kingdom?

Answers

Answer:

Whether the animal has a vertebral column or not.

extrusive rocks have larger grains than intrusive rocks.true or false and why

Answers

False because extrusive rocks have fine-grained texture due to the rapid cooling of magna above the earth surface. On the other hand extrusive rocks have course grained texture due to slow cooling of magna beneath the Earth's surface

As a discussed in the lesson, eukaryotic cels are differ from prokaryotic cells based on what three things?

Answers

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions

answer and show proof for brainliest

Answers

Answer:

C- South America. Because South America is mostly rain forest and forests in the northern and mid section of it.

Explanation:

What are examples of convections currents? What are examples of convection currents? A: the movement of war air into cooler air and cooler air into warmer air B: the movement of cool water into warmer water and warmer water into cool water. C: the displacement of air/water molecules by other air/water molecules due to varying temperatures. D: all of the above

Answers

Answer:

C: the displacement of air/water molecules by other air/water molecules due to varying temperatures

Osmotic pressure is: the pressure required to stop the flow of solvent from a region of high solute concentration to a region of low solute concentration. the pressure required to stop the rupture of the semipermeable membrane. the pressure required to reverse the flow of solvent through a semipermeable membrane during osmosis. the pressure required to stop the flow of solvent from a region of low solute concentration through a semipermeable membrane into a region of high solute concentration. None of these

Answers

Answer:

the pressure required to stop the flow of solvent from a region of low solute concentration through a semipermeable membrane into a region of high solute concentration.

Explanation:

Osmosis is the movement of water (solvent molecule) from a region of low solute concentration to a region of high solute concentration via a semipermeable membrane.

Osmotic pressure is the pressure (force) applied to a given solvent in order to prevent it's movement via osmosis across a semipermeable membrane. Since, osmotic pressure is the pressure required to stop osmotic process, then it can be further defined as follows:

Osmotic pressure is the pressure required to stop the flow of solvent from a region of low solute concentration through a semipermeable membrane into a region of high solute concentration.

The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it

Answers

Answer:

A) make new cells(somatic cells)and only germ-line cells do it(meiosis)

Explanation:

Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.

While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.

Meiosis produces germ cells while mitosis produces somatic cells.

Which is not a part of the digestive system?

A. Large Intestine

B. Small Intestine

C. Trachea

D. Esophagus

Answers

The correct answer is c trachea

in developing countries, which of the following is predicted to happen to both population and demand for meat and milk?

A. it will double by 2050
B. it will decrease by 2050
C. it will stay the same in 2050
D. it will increase slightly by 2050​

Answers

number c is the answer

You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele

Answers

Answer:

Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )

Explanation:

The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.

The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ).  hence option D is the correct answer.

How many hydrogen bonds are present in the base pairing of guanine and cytosine?
3

Answers

Answer:

3 Hydrogen bonds

Explanation:

Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds.

the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles​

Answers

the answer to the question is c

In pea plants, purple flowers (P) are dominant over white flowers (P). If two heterozygous purple flowered plants are
crossed with each other, then what are the possible genotypes of the offspring?
0
Answer is pp only

Answers

Answer :the answer is D

Explanation:

Other Questions
find the weight ? needed to hold the wall shown in fig. p2.76 upright. the wall is 10 m wide. Projections protruding from the bone to which muscles, tendons, and ligaments can attach; also known as a process, epicondyle, tubercle, and trochanter. Who do Napoleon and Snowball represent in real life? a company using apache activemq is migrating to the cloud. which aws service can it use to easily set up and operate its message brokers in the cloud? I have a little trouble finding the answer if any one knows please write the answer below if known. Cite Evidence: Reread the section Standing Strong. Why is it worthwhile to study balanced rocks? How can an individual shape public policy? which of the following research questions would best guide an investigation of the link between the structure of the signaling molecules and the evolution of quorum sensing? which of the following is a well-known framework for quantifying severity or the criticality of vulnerabilities? According to Milton Meltzer, how did Louis XIV maintain andconsolidate power? How do you grow a mongo seed in water? I need help i will choose you as the brainlyest answer is you get it right. What is the greatest common factor of 18 and 27 The range for the right hand side of the constraint show the limit within show the value of the RHS can be changed without changing the value of What are the three C in credit? What is the list order of accuracy for the second derivative Mcq? Which excerpt is an example of situational irony in sake's the storyteller? T/F in general, the metabolic oxidation of protein in mammals is less efficient, in terms of energy conserved, than the metabolic oxidation of carbohydrate or fat. Solve the system(4x + 7y= 41(x-7y=-16 What does spf stand for, and what is the difference between a spf 15 and a spf 30 sunscreen? How to find the possibility?