The spaceship Enterprise 1 is moving directly away from earth at a velocity that an earth-based observer measures to be 0.62c. A sister ship, Enterprise 2, is ahead of Enterprise 1 and is also moving directly away from earth along the same line. The veolcity of Enterprise 2 relative to Enterprise 1 is 0.30c. What is the velocity of Enterprise 2

Answers

Answer 1

Answer:

The answer is "0.92 c"

Explanation:

[tex]v_1\ (earth) = 0.62 \ c \\\\v_2\ ( enterprise ) = -0.30[/tex]

so,

[tex]v_2 \ (earth) = 0.62 \ c - (-0.30 \ c) \\\\[/tex]

               [tex]= 0.62 \ c +0.30 \ c\\\\= 0.92 \ c[/tex]


Related Questions

Questions
Rocking The... D ch
Two students are experimenting with two neutral objects - a foam square and a
sample of animal fur. They rub the two together and the foam square becomes
charged negatively and the fur becomes charged positively. Complete the
analysis of this situation.
#p*= #e
#p* > #e
#p* <#e
Before
#p*= #e
#p*> #e
#p* <#e
How did the foam square become charged?
Electrons were added to it.
Protons were added to it.
Electrons were removed from it.
Protons were removed from it.
#p*= #e
#p*> #e
#p* <#e
After
#p*= #e
#p* > se
#p* <#e

Answers

(A) In the given situation, when the foam square and animal fur are rubbed together, the foam square becomes negatively charged, and the fur becomes positively charged. (B) The foam square become charged because electrons were added to it. option(A)

(A) This occurs due to the process of triboelectric charging, also known as contact electrification. The foam square and animal fur are both electrically neutral before they are rubbed together, meaning they have an equal number of protons (#p*) and electrons (#e). However, when the two objects are rubbed, the surface of the foam square and the fur come into contact, causing the transfer of electrons between them.

The final charge distribution can be summarized as follows:

Before: #p* = #e (Equal number of protons and electrons)

After: #p* = #e (Number of protons remains the same)

       #p* > #e (Excess of electrons on the foam square)

       #p* < #e (Deficit of electrons on the fur)  

(B) During the rubbing process, the foam square gains electrons from the fur, resulting in an excess of electrons on the foam square's surface. This accumulation of electrons gives the foam square a negative charge. Conversely, the fur loses electrons, resulting in a deficit of electrons and an overall positive charge on its surface.

The foam square becomes charged negatively because electrons are added to it during the rubbing process. It is important to note that the transfer of charge occurs through the exchange of electrons, not protons. The number of protons in the foam square and fur remains the same before and after the rubbing process, so #p* remains unchanged. option(A)

For such more questions on electrons

https://brainly.com/question/860094

#SPJ8

Select the correct answer.
F₁ = 70 N
F₂ = 15 N
8
F₁
W = 80 N
Use this free body diagram to help you find the magnitude of the force F₁ needed to keep this block in static equilibrium.

Answers

Explanation:

F1 will have to have  65 N vertical up force to balance the net 65 N down on the body  AND it will have to have  70 N horizontal to the right to balance the 70 N force that is acting to the left

Magnitude = sqrt ( 65^2 + 70^2) = 95.5  N

What is the approximate surface temperature of the 'White Dwarfs'?.
2,500-5,000 K
5,000-10,000
10,000-15,000 K
15,000 K-35,000 K

Answers

Answer:

5,000-10,000 K

Explanation:

make me your brainlist pls

When jeremiah stands in a swimming pool and looks at hid feet, his legs appear to be bent. Which is the term for this phenomenon?
A. Diffraction
B. Dispersion
C. Reflection
D. Refraction

Answers

D: Refraction
Explanation: Refraction occurs when a medium bends the light rays of an object. Like water for instance as an example of a medium.

The potential energy of a mass-spring system when the spring is fully compressed and the mass is at rest is 200 J. After releasing the mass, assuming there is no dissipative force, the system will oscillate. At a point during the oscillation the potential energy of the system is 50 J. What is the kinetic energy of the mass at that point

Answers

Answer:

150 J

Explanation:

If there is not any dissipative force in the system, the mass and the spring will oscillate eternally., but of course, we assume this is a theoretical situation. The conservation of energy in a system implies that the sum of the potential energy plus kinetic energy remains constant, therefore if in the initial point the mass has 200 J (potential energy) and is at rest ( kinetic energy = 0) the overall energy at the beginning is 200 J. At any point of the oscillation if the potential energy is 50 J the kinetic energy must be 150 J.

What is sound waves

Answers

Sound waves are a type of mechanical wave that propagate through a medium, typically air but also other materials such as water or solids.

Characteristics of sound waves

Frequency: the frequency of a sound wave refers to the number of cycles or vibrations it completes per second and is measured in Hertz (Hz).

Amplitude: the amplitude of a sound wave refers to the maximum displacement or intensity of the wave from its equilibrium position. It represents the loudness or volume of the sound, with larger amplitudes corresponding to louder sounds and smaller amplitudes corresponding to softer sounds.

Wavelength: the wavelength of a sound wave is the distance between two consecutive points in the wave that are in phase, such as from one peak to the next or one trough to the next. It is inversely related to the frequency of the wave.

Learn more about sound waves at

https://brainly.com/question/1199084

#SPJ1

If a quarterback gets hit by a defensive lineman with a mass of 100 kg and accelerating at a rate of 1m/s2 at what force is the quarterback getting hit? ​

Answers

The quarterback is getting hit with a force of 100 Newtons.

How to calculate the force with which the quarterback is getting hit

We can use Newton's second law of motion:

Force = Mass * Acceleration

Given that the mass of the defensive lineman is 100 kg and the acceleration is 1 m/s², we can substitute these values into the equation:

Force = 100 kg * 1 m/s²

Force = 100 N

Therefore, the quarterback is getting hit with a force of 100 Newtons.

Learn more about  Newton's second law here : brainly.com/question/1121817

#SPJ1

if matter cannot be created nor destroyed where did the matter in the univerce com from ???????
BIG BRAIN

Answers

i have no idea

I don't even know how we are here

Water can form large dewdrops in nature how would droplets made of isopropyl alcohol instead of water be different

Answers

Answer:

isopropyl alcohol would form smaller droplets, because it has lower surface tension than water has

Explanation:

Ap3x

The droplets made of isopropyl alcohol instead of water be smaller due to surface tension.

What is droplets?

The single drop of a liquid in the form of sphere is called droplet.

Water can form large dewdrops in nature. Isopropyl alcohol would form smaller droplets, because it has lower surface tension than water.

Surface tension is the property of the liquid to acquire minimum surface area.

Thus, droplets made of isopropyl alcohol instead of water be smaller.

Learn more about droplet.

https://brainly.com/question/2926487

#SPJ2

a)
What is the net force on the refrigerator shown to the right?
200 N
1,000 N
50 N
= Fg
1,000 N = F.
b) Calculate the mass of the refrigerator.
c) What is the refrigerator's acceleration?

Answers

Answer:

50N

Explanation:

is the opposing fotce

This photo shows a beam of light entering and exiting a piece of glass.
What happens when the light enters the glass?
A. The light is absorbed.
B. The light is reflected.
C. The light is scattered.
D. The light is refracted.

Answers

I think it’s D: The light is refracted

Answer:

D. The Light Is Refracted

Explanation:

<3

A loop of wire carrying a current of 2.0 A is in the shape of a right triangle with two equal sides, each 15 cm long. A 0.7 T uniform magnetic field is parallel to the hypotenuse. The total magnetic force on the two equal sides has a magnitude of:Group of answer choices0.30 N0 N0.51 N0.41 N

Answers

Answer:

the total magnetic force on the 2 sides of the wire is 0.30 N

Option a) 0.30 N is the correct answer

Explanation:

Given the data in the question;

both the sides of the right angled triangle is the same and the magnetic is in the plane of the  triangle and is perpendicular to the hypotenuse.

hence, angle between the magnetic field and both the sides of the triangle is 45 degrees.

∅ = 45°

I = 2.0 A

L = 15 cm = 0.15 m

B = 0.7 T

Total magnetic force on the 2 sides of the wire will be;

F = 2BILsin∅

we substitute

F = 2 × 0.7 × 2.0 × 0.15 × sin(45°)

F = 0.42 × 0.70710678

F = 0.2970 ≈ 0.30 N

Therefore, the total magnetic force on the 2 sides of the wire is 0.30 N

Option a) 0.30 N is the correct answer

How many gallons of water does it take to produce the following:
a. Cheeseburger
b. Pound of butter
c. A pair of jeans

Answers

Answer:

a. 660 gallons

b.665 gallons

c. 1,800

Samir is waiting for a slow reaction to finish. What is the best way to make the reaction go faster?

Question 12 options:

Put it in the fridge where it is cold


Cover it with a blanket so it's dark


Warm it up on the stove


There is nothing you can do to change the speed of the reaction

Answers

In general, option c - warming it up on the stove - is often an effective method to increase the reaction rate.

Increasing the temperature of a reaction generally leads to faster reaction rates. This is because higher temperatures provide more thermal energy to the reactant particles, causing them to move faster and collide more frequently. The increased collision frequency and energy lead to more successful collisions and a higher likelihood of effective molecular interactions, which speeds up the reaction. On the other hand, options a and b - putting it in the fridge where it is cold or covering it with a blanket to make it dark - are unlikely to have a significant effect on the reaction rate. While temperature can influence reaction rates, cooling the reaction or making it dark typically reduces the kinetic energy of the particles, resulting in slower reaction rates. Option d - there is nothing you can do to change the speed of the reaction - is not accurate. The reaction rate can be influenced by various factors such as temperature, concentration, catalysts, and surface area, among others. By manipulating these factors, it is often possible to control and change the speed of a reaction. Hence option c, is correct

for more questions on reaction
https://brainly.com/question/4431224
#SPJ8

You are testing a new amusement park roller coaster with an empty car with a mass of 130 kg . One part of the track is a vertical loop with a radius of 12.0 m . At the bottom of the loop (point A) the car has a speed of 25.0 m/s and at the top of the loop (point B) it has speed of 8.00 m/s . Part A As the car rolls from point A to point B, how much work is done by friction

Answers

Answer:

work done by friction = 5889 J

Explanation:

We are given;

Mass of car; m = 130 kg

Speed at point A; v1 = 25 m/s

Speed at point B: v2 = 8 m/s

Since radius is 12 m

At point A, distance is; y1 = 12 m

At point B, distance is; y2 = -12 m

Now, formula for work done by all the forces is given by the equation;

Total work;

W_gravity + W_others = K2 - K1

Where W_others is work done by other forces which is equal to work done by friction

Where K2 - K1 is change in kinetic energy.

W_grav is also change in potential energy and is expressed as;

W_grav = mgy1 - mgy2

K2 - K1 = ½m(v1)² - ½m(v2)²

Thus;

mgy1 - mgy2 + W_others = ½m(v1)² - ½m(v2)²

Making W_others the subject;

W_others = ½m(v1)² - ½m(v2)² + mgy2 - mgy1

Plugging in the relevant values;

W_others = (½ × 130 × 25²) - (½ × 130 × 8²) + (130 × 9.8 × -12) - (130 × 9.8 × 12)

W_others = 5889 J

Recall that I earlier said W_others = work done by friction.

Thus, work done by friction = 5889 J

A car accelerates from rest to 35m/s in a distance of 88 m. What was its acceleration in m/s2, assumed constant?

Answers

Answer:

6.96ms/2 or 7ms/2

Explanation:

v2=u2 +2as second equation of motion

u=o

v=35

S=88

a=?

35^2=0^2 +2xax88

=1225 =0+176a

1225=176a

1224/176=6.96ms/2 or 7ms/2

FIRST CORRECT ANSWER GETS BRAINLIEST!!!

Answers

Answer:

Light is being absorbed

Hope this helps!

Light is being absorbed

Raven knows that ammonia will react with vinegar when they are both dissolved in water. She's concerned the reaction will go too quickly. How can she slow down the reaction?

Question 13 options:

Increase the concentration of dissolved substances


Decrease the concentration of dissolved substances


Add a catalyst


There's nothing she can do to change the rate of reaction.

Question 14 (2 points)
Which of the following is a solution?

Question 14 options:

Popcorn


A salad


Pure water


Salt dissolved in water

Question 15 (2 points)
The picture shows two solutions of salt water. Which solution is more concentrated (has a higher concentration)?



Question 15 options:

The first solution is more concentrated


The second solution is more concentrated


The solutions have the same concentration.

Question 16 (2 points)
What must occur for particles to react?

Question 16 options:

They must collide


They must photosynthesize


They must condense


They must melt

Question 17 (3 points)
In your opinion, what the most important OR interesting thing from this unit? If you didn't find anything interesting, please write one thing that you learned.

Write a full sentence, please.

Question 17 options:

Answers

Raven can slow down the reaction by decreasing the concentration of dissolved substances (option B). A salt dissolved in water is an example of solution (option D). Particles must collide in order to react (option A).

What is a solution?

A solution is a homogeneous mixture, which may be liquid, gas or solid, formed by dissolving one or more substances.

According to this question, a salt dissolved in water is an example of solution because it involves a solute and a solvent.

The rate of a chemical reaction can be decreased by reducing the concentration of the reactants so as not to provoke a reaction.

In a chemical reaction, the particles of the reactants must collide to initiate the reaction.

Learn more about solution at: https://brainly.com/question/1616939

#SPJ1

What is respiration?

Answers

Answer:

taking in oxygen and giving out carbon dioxide is called respiration

Answer:

i think that respiratiln is when you breqth

Scientists have concluded that the uppermost part of the mantle is partially-molten. Which observation helped them reach this conclusion?

Answers

Answer:

 P and S waves slow down when they reach this layer. The asthenosphere, also known as the magma chamber, is the uppermost component of the mantle. This layer is partially molten and is a ductile zone in a tectonically poor state.

It's almost hard and seismic waves move through the asthenosphere at a slow rate. The fragile lithosphere and the uppermost portion of the asthenosphere are assumed to be rigid.

seismic waves travel more quickly through denser materials and therefore generally travel more quickly with the depth it moves more slowly through a liquid than a solid. Molten areas within the Earth slow down P waves and stop S waves because their shearing motion cannot be transmitted through a liquid. Partially molten areas may slow down the P waves and attenuate or weaken S waves.

hope this helps...

S and P wave slow down and stop in  the uppermost part of the mantle. - For this, scientists have concluded that the uppermost part of the mantle is partially-molten.

What is mantle?

A planetary body's mantle is a layer that is surrounded by the crust on top and the core underneath. The largest and most substantial layer of a planetary body, mantles are often comprised of rock or ice. Planetary bodies that have undergone density differentiation typically have mantles. Mantles are found on all terrestrial planets (including Earth), many asteroids, and a few planetary moons.

Between the crust and the outer core, there is a silicate rock layer known as the Earth's mantle. Despite being mostly solid, it behaves like a viscous fluid over geological time. Oceanic crust is created by the partial melting of the mantle at mid-ocean ridges, and continental crust is created by the partial melting of the mantle at subduction zones.

Learn more about mantle here:

https://brainly.com/question/28827790

#SPJ2

Electricity is distributed from electrical substations to neighborhoods at 13000 V. This is a 60 Hz oscillating (AC) voltage. Neighborhood transformers, seen on utility poles, step this voltage down to the 120 V that is delivered to your house.
A. How many turns does the primary coil on the transformer have if the secondary coil has 120 turns?

Answers

Answer:

the number of turns in the primary coil is 13000

Explanation:

Given the data in the question;

V₁ = 13000 V

V₂ = 120 V

N₁ = ?

N₂ = 120 turns

the relation between the voltages and the number of turns in the primary and secondary coils can be expressed as;

V₁/V₂ = N₁/N₂

V₁N₂ = V₂N₁

N₁ = V₁N₂ / V₂

so we substitute

N₁ = (13000 V × 120 turns) / 120 V

N₁ = 1560000 V-turns / 120 V

N₁ = 13000 turns

Therefore, the number of turns in the primary coil is 13000

3) Which of the following can affect the success of a start-up business?
A) the entrepreneur's ability to communicate
B) the entrepreneur's ability to resolve conflict
C) the entrepreneur's ability to work with his employees
D) all of the above

Answers

Answer:

all of the above.

Explanation:

all of these qualities are crucial in order to have a successful business.

What voltage would be measured across the 15 ohm resistor?
A)
2.5 volts
B)
5.0 volts
C)
7.5 volts
D)
10 volts

Answers

Answer:

7.5 volts

Explanation:

I did it on USA Testprep

Why do herbivores of the Serengeti migrate year after year

Answers

Answer:

The main reason is that very young calves are more noticeable to predators when mixed with older calves from the previous year

Explanation:

They are forced to migrate by carnivores that hunt them.

2. Suppose that an incompressible fluid passes through a pipe that changes in cross-sectional area from 0.25 m2 to 0.125 m2. How will this affect the fluid velocity? (10 points)

Answers

Answer:

The fluid velocity will increase as it passes through the pipe with the decreasing cross-sectional area.

Explanation:

According to the principle of continuity in fluid dynamics, the product of the fluid's cross-sectional area and its velocity remains constant as it flows through a pipe, assuming the fluid is incompressible and there are no sources or sinks of fluid along the pipe.

In this scenario, as the cross-sectional area of the pipe decreases from 0.25 m² to 0.125 m², the fluid velocity will increase. This is because the product of the area and velocity must remain constant, and since the area decreases, the velocity must increase to compensate and maintain the constant product.

Mathematically, we can express this relationship as:

A₁V₁ = A₂V₂

Where A₁ and A₂ are the initial and final cross-sectional areas of the pipe, and V₁ and V₂ are the initial and final velocities of the fluid.

Since A₂ (0.125 m²) is smaller than A₁ (0.25 m²), V₂ must be larger than V₁ to satisfy the equation. Therefore, the fluid velocity will increase as it passes through the pipe with the decreasing cross-sectional area.

Hope this helps!

What are the five classes of objects that orbit the sun?​

Answers

Planets moons asteroids comets and meteoroids

Need a 5 paragraph essay in the eartsh layers and how they function/ benefit the earth!

Answers

There is more to the Earth than what we can see on the surface. In fact, if you were able to hold the Earth in your hand and slice it in half, you'd see that it has multiple layers. But of course, the interior of our world continues to hold some mysteries for us. Even as we intrepidly explore other worlds and deploy satellites into orbit, the inner recesses of our planet remains off limit from us.

However, advances in seismology have allowed us to learn a great deal about the Earth and the many layers that make it up. Each layer has its own properties, composition, and characteristics that affects many of the key processes of our planet. They are, in order from the exterior to the interior – the crust, the mantle, the outer core, and the inner core. Let's take a look at them and see what they have going on.

Like all terrestrial planets, the Earth's interior is differentiated. This means that its internal structure consists of layers, arranged like the skin of an onion. Peel back one, and you find another, distinguished from the last by its chemical and geological properties, as well as vast differences in temperature and pressure.

Explanation:

In the past, asteroids striking the earth have produced disastrous results. If we discovered an asteroid on a collision course with the earth, we could, in principle, deflect it and avoid an impact by focusing a laser on the surface. Intense surface heating from the laser could cause surface material to be ejected into space at high speed.

Required:
How would this deflect the asteroid?

Answers

Answer:

Explained below.

Explanation:

We are told that the surface material is ejected into space at a high speed. This means that it will have a likely high momentum as well.

Now, we can say that the total momentum is conserved because the entire asteroid system behaves like an isolated system.

Also, as the surface material is moving with the high momentum like we established earlier, it will cause the asteroid to move with a speed in an opposite direction which also means deflection in an opposite direction.

Answer:

Explained below.

Explanation:

The material ejected from the surface of the asteroid would have a significant momentum. Since the asteroid and all its material is an isolated system, the ejection would cause an oppositely directed change in momentum of the asteroid, according to the law of conservation of momentum.

The ejected material is analogous to gases expelled from a rocket, and the asteroid is analogous to a rocket.

20. How does a paraxylene crystallizer operate?

Answers

In the CrystPX Technology process, suspension crystallization of paraxylene (PX) in the xylene isomer mixture is used to produce paraxylene crystals.  At the back end of the process, high paraxylene recovery is obtained by operating the crystallizers at colder temperatures.

Paraxylene crystals are created using the CrystPX Technology by suspending paraxylene (PX) in a mixture of xylene isomers. High paraxylene recovery is achieved at the end of the process by running the crystallizers at lower temperatures.

What does a paraxylene crystallizer operate?

The paraxylene technology from BP, a novel method using single stage crystallization for paraxylene (pX) recovery, is licensed exclusively to Lummus Technology for use around the world.

This cutting-edge architecture makes the Lummus Technology/BP pX crystallization technology the most energy-efficient paraxylene recovery process, together with excellent feed impurity tolerance and low total unit fuel consumption.

The Lummus Technology/BP paraxylene process has a high degree of dependability, is inexpensive, and can take a variety of feed compositions.

Therefore, With the aid of isomerization over a non-noble metal catalyst, the yield of xylene is improved even further. Optimized fractionation lowers reboiler duty, resulting in less energy use and emissions.

Learn more about crystallizer here:

https://brainly.com/question/20725934

#SPJ2

Please help me with this question. Every help is appreciated.

Answers

Answer:

Change in KE = +1.96×10^4 J while the change in ME = 0 J

Other Questions
historically, demand has averaged 408 units per week with a standard deviation of 160. the company currently has 48 units in stock. what is the probability of a stockout?a.225.0% b. 48.778% c.1.222% d..98.778% e.50.000% One of the tables below contains (X, Y) values that were generated by a linear function. Determine which table, and then write the equation of the linear function represented by the:Table #1:X 2 58111417 20Y1 3713213143Table #2:X 1234567Y 10 13 18 21 26 29 34Table #3:X2 4 6 8101214Y1 61116212631Equation of a Line in:A line in R is composed of a set of ordered pairs possessing the same degree of slope.To structure the equation of a line, we must have a point (a,b) and the slope. Which of the following is not an example of a capital investment? ...Which of the following is not an example of a capital investment? A.)The implementation of a new manufacturing technique.B.)The purchase of raw materials for inventory.C.) The installation of a computer based record keeping system. D.)The expansion of a business into new territories. E.)The purchase of new manufacturing equipment. Vera has an adjustable-rate mortgage, and her monthly payments are reset annually based on the prevailing market rate. She is wondering about the effect of an increase of 0.5 percent in the interest rate on her mortgage payment. Vera is O displaying traits of an agonizer. O conducting a sensitivity analysis. O estimating her opportunity cost. O conducting incremental analysis. discuss the link between agenda setting and the development of legislation. the function analogwrite(5, 100), will produce how much average voltage on pin 5? group of answer choices between 0 to 2 volt between 2 v to 5 v 5 v 100 v as this section has demonstrated, people in high-income countries generally have better health than those in low-income countries. think back to what you learned about theories of global inequality. Please help me Im timed Find the general solution of the nonhomogeneous differential equation, 2y""' + y" + 2y' + y = 2t2 + 3. Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate. Police infotainment tends to privilege which criminal justice frames? T/F. robust australopithecines had large chewing muscles but lacked a sagittal crest.