The two figures shown are congruent. Which statement is true?

The Two Figures Shown Are Congruent. Which Statement Is True?

Answers

Answer 1

Answer:reflection image of the other

Source:trust me bro

Answer 2
The last choice because it’s like you drawing it on a peace of paper and then folding the paper in half and then rubbing it on the other said of the paper

Related Questions

What is the slope of a line perpendicular to the line whose equation is 3x+y=-5 Fully reduce your answer.

Answers

Answer:

The answer is 1/3

Step-by-step explanation:

The fair spinner shown in the diagram above is spun.
Work out the probability of getting a 5.
Give your answer as a fraction in its simplest form.

Answers

Answer:

1/5

Explanation:

There are five choices in the spinner. One of the choices is labeled '5'. That means you will have one out of the 5 choices to get the choice labeled '5'.

Good day :)

Find the value of the power 6 to the -4th

Answers

Answer:

6 to the -4th is 7.716 x 10^-4

Step-by-step explanation:

A random sample of 500 people is taken. 260 of them rent (as oppose to own) their residence. Compute a 95% confidence interval for the true proportion

Answers

Answer: A 95% confidence interval for the true proportion (p) will be (0.4762136, 0.5637864).

Step-by-step explanation:

Let p = True proportion of people rent their residence.

Given: n= 500

People rent their residence = 260

[tex]p=\dfrac{260}{500}=0.52[/tex]

z-value for 95% confidence level = 1.96

A 95% confidence interval for the true proportion will be :

[tex]p\pm z^*\sqrt{\dfrac{p(1-p)}{n}}[/tex]

[tex]0.52\pm (1.96)\sqrt{\dfrac{0.52(1-0.52)}{500}}\\\\=0.52\pm(1.96\sqrt{\dfrac{0.2496}{500}})\\\\=0.52\pm 1.96\sqrt{0.0004992}\\\\=0.52\pm (1.96)(0.02234)\\\\=0.52\pm0.0437864\\\\=(0.52-0.0437864,\ 0.52+0.0437864)\\\\=(0.4762136,\ 0.5637864)[/tex]

A 95% confidence interval for the true proportion (p) will be (0.4762136, 0.5637864).

Solve for x.

0 ≤ 3x – 6 ≤ 18

Answers

Answer:

Inequality form: 2 [tex]\leq[/tex] x [tex]\leq[/tex] 8

Interval Notation: [2,8]

Step-by-step explanation:


What is zw?
need help asapppppp

Answers

Answer:

2nd one

Step-by-step explanation:

It takes Andre 4 minutes to swim 5 laps. a.How many laps per minute is that?

Answers

Answer:

1.25 laps per minute

Step-by-step explanation:

1.25 laps per minute

Do the ratios 3/20 and 1/4 form a proportion?

Answers

Answer:

yes

Step-by-step explanation:

if the denomentators are dividable, than it is a equivalent equation

through: (-5, 4), parallel to y=--x+4

Answers

Answer:

y=-x-1

Step-by-step explanation:

1.) equation of line in slope-intercept form: y=4-x

2.) parallel of line is same as: m=-1

3.) equation of parallel line is: y=-x+b

4.) finding b: 4=(−1)⋅(−5)+b

b=-1

5.) therefore, equation is y=-x-1

Write an inequality for the following 2 STATEMENTS. You
do NOT need to solve them.


1)two less than a number is less than 9

2)the sum of a number and 8 is more than 4

Answers

Answer:

We

Given below are pictures of some common reptiles. Unscrambles

land and water.

jumbled letters and write their names:

an

P

1.

2.

Snake

TLALIGAOR

3.

KNSAE

4.

TRUTLE​

Step-by-step explanation:

A trade-in is most closely related to which of the following?
a.
A down payment, because it reduces the amount financed.
b.
An interest payment, because it represents value given to the dealer.
c.
The list price, because it is derived from the price of a car.
d.
Amortization, because it is a way of paying for car financing.

Answers

Answer:c.

The list price, because it is derived from the price of a car.

Step-by-step explanation:

Tess is going to purchase a new car that has a list price of $29,190. She is planning on trading in her good-condition 2006 Dodge Dakota and financing the rest of the cost over four years, paying monthly. Her finance plan has an interest rate of 10.73%, compounded monthly. Tess will also be responsible for 7.14% sales tax, a $1,235 vehicle registration fee, and a $97 documentation fee. If the dealer gives Tess 75% of the listed trade-in price on her car, once the financing is paid off, what percent of the total amount paid will the interest be? (Consider the trade-in to be a reduction in the amount paid.)         ANSWER C

Answer: A. A down payment, because it reduces the amount financed.

Step-by-step explanation: I just took the quiz and got a 100%. Edge 2021

The Ferris wheel is the most popular ride. In 1 hour, the Ferris wheel had 240 riders. If that was 60% of the total number of riders, then how many riders did the Ferris wheel have?!!PLEASE ANSWER!!

Answers

Answer:

400 riders

Step-by-step explanation:

The Ferris wheel had 400 riders.

400*0.60=240.

Answer:

Y = 144

Step-by-step explanation:

60 times  = 14400

14400 = y times 100

       

64% of students will apply for graduate school. from a sample of 100 students, 52 stating that they will apply for grad school. for alpha=.01 you ___ hypothesis

Answers

Answer:

you accept the alternative hypothesis

Step-by-step explanation:

The null and alternative hypothesis can be computed as follows:

[tex]H_o: p = 0.64 \\ \\ H_1: p \le 0.64[/tex]

The sample proportion [tex]\hat p = \dfrac{x}{n}[/tex]

[tex]\hat p = \dfrac{52}{100}[/tex]

[tex]\hat p = 0.52[/tex]

The test statistics can be computed as:

[tex]Z = \dfrac{\hat p -p_o}{ \sqrt{ \dfrac{p_o \times (1-p_o)}{ n} }}}[/tex]

[tex]Z = \dfrac{0.52 -0.64}{ \sqrt{ \dfrac{0.64 \times (1-0.64)}{ 100} }}}[/tex]

Z = -2.5

The P-value = 2( Z< -2.5)

From the tables;

The P-value = 2 (0.0062)

The P-value = 0.0124

The significance level = 0.01

Since the P-value is > significance level; we fail to reject the null hypothesis.

Conclusion: we accept the alternative hypothesis

Using the z-distribution, it is found that since the test statistic is less than the critical value for the left-tailed test, it is found that there is enough evidence to conclude that the percentage is less than 64%.

At the null hypothesis, it is tested if the proportion is of 64%, that is:

[tex]H_0: p = 0.64[/tex]

At the alternative hypothesis, it is tested if the proportion is less than 64%, that is:

[tex]H_1: p < 0.64[/tex]

The test statistic is given by:

[tex]z = \frac{\overline{p} - p}{\sqrt{\frac{p(1-p)}{n}}}[/tex]

In which:

[tex]\overline{p}[/tex] is the sample proportion. p is the proportion tested at the null hypothesis. n is the sample size.

For this problem, the parameters are: [tex]n = 100, \overline{p} = \frac{52}{100} = 0.52, p = 0.64[/tex]

Hence:

[tex]z = \frac{\overline{p} - p}{\sqrt{\frac{p(1-p)}{n}}}[/tex]

[tex]z = \frac{0.52 - 0.64}{\sqrt{\frac{0.64(0.36)}{100}}}[/tex]

[tex]z = -2.5[/tex]

The critical value for a left-tailed test, as we are testing if the proportion is less than a value, using the z-distribution with a significance level of 0.01, is of [tex]z^{\ast} = -2.33[/tex]

Since the test statistic is less than the critical value for the left-tailed test, it is found that there is enough evidence to conclude that the percentage is less than 64%.

For more on the use of the z-distribution for hypothesis tests, you can check https://brainly.com/question/25584945

3.) Jimena used her calculator to divide 2 by 13.
The calculator screen shows the number: 0.1538461.
Round Jimena's answer to the nearest tenth. =

Answers

Answer: 0.2

Step-by-step explanation:

Solve the system by substitution. y = 8x + 32 Y= -8x​

Answers

the answer is (x,y) = (-2, 16)

do you need an explanation as well?

please help picture included:)

Answers

Answer:

y = 75

z = 43.3

Step-by-step explanation:

To find the value of y we use the trigonometric identity Sine.

[tex]sin\ 30 = \frac{y}{150}\\\\y=150*sin30\\y= 75\\[/tex]

Now to find the value of z we can use the trigonometric identity Tangent.

[tex]tan\ 60=\frac{y}{z}\\\\z=\frac{y}{tan\ 60}[/tex]

We know the value of y is 75 so it becomes,

[tex]z=\frac{75}{1.732} \\\\z=43.3[/tex]

Answer:

y=-150 ' z = - 468

Step-by-step explanation:

Sin angle = opp/hyp

Cos 30 = y/150

y = 150 ×( cos30)

y= - 150

Tan angles = opp / adj

Tan 60 = - 150 / Z

Z = (-150) / tan 60

Z = (-150) / 0.32

Z= - 468

ASAP please help me I need this quick
The question and answers are in the picture

Answers

Answer:

25

Step-by-step explanation:

maybe this will help you

Answer:

C. 125 cm^3

Step-by-step explanation:

Hope this helps!! Brainliest please :)

Using the table below,which statement best describes whether or not the relationship identifies a function?

Answers

Answer: I'm pretty sure the correct answer is (B)  Let me know if i'm correct!

Step-by-step explanation:

How many solutions does the equation 3x + 6 = −1 − 3 + 4x have? (5 points)

Two
None
One
Infinitely many

Answers

Answer:

The equation has only one solution which is:

[tex]x = 10[/tex]

Step-by-step explanation:

Given the equation

[tex]3x\:+\:6\:=\:-1\:-\:3\:+\:4x[/tex]

Let us solve the equation to determine the type of the equation

[tex]3x\:+\:6\:=\:-1\:-\:3\:+\:4x[/tex]

subtract the number: -1 - 3 = -4

[tex]3x+6=4x-4[/tex]

subtract 6 from both sides

[tex]3x+6-6=4x-4-6[/tex]

[tex]3x=4x-10[/tex]

subtract 4x from both sides

[tex]3x-4x=4x-10-4x[/tex]

[tex]-x=-10[/tex]

Divide both sides y -1

[tex]\frac{-x}{-1}=\frac{-10}{-1}[/tex]

[tex]x=10[/tex]

Therefore, the equation has only one solution which is:

[tex]x = 10[/tex]

Answer:

C one

Step-by-step explanation:

I toolk the test

Could someone help me

Answers

Last one :) shahshshshdhdbdgd

Answer:

its the last one

because the rest of them are wrong


Which proportion would be used to solve the following problem. The proportion of turtles to alligators at the reptile park is 5:9. Since Beth
counted 45 turtles, how many alligators are there?

Answers

Answer:

25 I think not sure

Step-by-step explanation:

A police department reported that approximately 5% of the alarm calls they get each day are real emergencies and not false alarms. If they receive 120 alarm calls in one day, about how many of them would be false alarms?​

Answers

Answer:

6

Step-by-step explanation:

5% of 120 is 6.

Well, if 5% of them are real, that means 95% of the calls they get each day are false alarms.  

If we set up our inequality and multiply (Which i'm assuming you know how to do) We would get 114. Therefore, 114 calls would be false alarms.

19 X 6 fill in the blanks

Answers

answer: 114
no explanation


If two lines are perpendicular, their slopes are negative reciprocals.
A. True
B.False

Answers

A. If the slopes of two lines are negative then the reciprocals, of the lines are perpendicular.
THE ANSWER IS TRUE I’M 100%

Pran ran 29 miles less than Robin last week. Pran ran 19 miles. How many
miles did Robin run?

Answers

Pran= 19
Robin= 29+19

29+19= 48

If 16g if a radioactive substance are present initially and 5yr later only 8g remain how much substance will be present after 9yr

Answers

9514 1404 393

Answer:

  4.59 g

Step-by-step explanation:

The half-life is given as 5 years, so the amount remaining after 9 years will be ...

  remaining = initial × (1/2)^(t/(half-life))

  remaining = (16 g)×(1/2)^(9/5) ≈ 4.59 g

About 4.59 g of the substance will remain after 9 years.

Suppose y varies directly with x. When x is 2, y is 20. What is x when y is 50

Answers

Answer:

5

Step-by-step explanation:

x = 2 >>> (Multiply by 10) >>> y = 20

x = ? >>> (Multiply by 10) >>> y = 50

50 ÷ 10 = 5

x = 5 when y is 50

y=-3x2 + 18x + 10?
What is the axis of symmetry

Answers

Answer:

x = 3

Step-by-step explanation:

The formula for the axis of symmetry is x = -b/[2a].  Here, a = -3 and b = 18.

             

                                                            -18

Thus, the axis of symmetry is x = - ------------ = 3, or x = 3

                                                            2[-3]

3 inches
1.5 inches
1.5 inches

Answers

Answer:

6 inches

Step-by-step explanation:

someone help me please i don’t understand

Answers

Answer:

i need points lol .

Step-by-step explanation:

i need points :(  i hope you find your answer i guess

Other Questions
Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation The students are trying to raise 3.000 but they only have 1200 how much would they need to get to 3000