Using information you learned from this unit, write a paragraph (100-200 words) explaining how oracle bones were supposed to work.

Answers

Answer 1

Answer:

Oracle bones were shoulder blades of animals which were also known as a dragon bone. They would draw symbols on the bones and fortune tellers use them to tell the future. Most of the oracle bones came from the Shang Dynasty and fro Zhou Dynasty. Fortune telling was a big part for them to make decisions and not only for kings but everybody used it regularly. After that oracle bones weren’t used as regularly. The areas of the bone work shops were neglected and unused with the new dynasty. The Zhou Dynasty used other methods of telling the future, such as I-Ching which used hexagrams and yarrow sticks.

Explanation:

That’s 108 words


Related Questions

When the Constitution is called the "supreme law of the land" what is meant?



it is a document bathed in truth and wrapped in wisdom


it is a time-honored document that has been flexible enough to withstand change, yet rigid enough to maintain its integrity.


it is the highest form of law in the United States


it has allowed for the strength of a federal union, while allowing for local administration to be handled locally

Answers

Answer:

The U.S. Constitution identifies the supreme law of the land as follows: "This Constitution, and the Laws of the United States which shall be made in Pursuance thereof; and all Treaties made, or which shall be made, under the Authority of the United States, shall be the supreme Law of the Land; and the Judges in every State shall be bound thereby, any Thing in the Constitution or Laws of any State to the Contrary notwithstanding" (Article VI, Paragraph 2). This passage, known as the supremacy clause, asserts that, in the United States, the federal constitution and federal laws take precedence over state constitutions and state laws. More generally and informally, the "supreme law of the land" refers to the highest or most authoritative form of law in a given country, usually its written constitution.

Explanation:

It’s the Congress all the power has

What did the Egyptians learn
from the Hyksos? How might
this have helped the Egyptians
after they had driven the
Hyksos from their land?

Answers

Answer:

The Hyksos (/ˈhɪksɒs/; Egyptian ḥqꜣ(w)-ḫꜣswt, Egyptological pronunciation: hekau khasut, "ruler(s) of foreign lands"; Ancient Greek: Ὑκσώς, Ὑξώς) were people of probable Levantine origin, who established the Fifteenth Dynasty of Egypt based at the city of Avaris in the Nile delta, from where they ruled the northern part of the country. While the Hellenistic Egyptian historian Manetho portrayed the Hyksos as invaders and oppressors, modern Egyptology no longer believes that the Hyksos conquered Egypt in an invasion. Instead, Hyksos rule had been preceded by groups of Canaanite peoples settled in the eastern delta who probably seceded from central Egyptian control near the end of the Thirteenth Dynasty.

Explanation:

As far as the courts are concerned, free speech and free expression means the same thing. True or False?

Answers

Answer:

True, also another commonly used term is "freedom of speech or freedom of expression"

Explanation:

I’ll give the Brainliest.

Explain this what this cartoon means. Identify who or what is the subject of the cartoon as well as what is being said by the cartoon.

Thank you!

Answers

Answer:

King Andrew the First is a famous American political cartoon created by an unknown artist around 1832. The cartoon depicts Andrew Jackson, the 7th United States president, as a monarch holding a veto bill and trampling on the Constitution and on internal improvements of the national bank.

Explanation:

Answer: King Andrew the First is a famous American political cartoon created by an unknown artist around 1832. The cartoon depicts Andrew Jackson, the 7th United States president, as a monarch holding a vetoed bill and trampling on the Constitution and on internal improvements of the national bank.

Explanation: What She Said. {jonesalexandria76}

Which was a belief of the early Federalist Party? The United States should become allies with France. The United States should have a small federal government. The United States should not have a national bank. The United States should not take sides in foreign wars.

Answers

Answer:

D

Explanation:

Answer:

d

Explanation:

just took the quiz

Which of the following strategies is most similar to a strike?

Answers

Answer:

boycotting!!!!!!!!!!!

Explanation:

who determines prices in socialism?

Answers

Answer:

Government

Explanation:

Under a true socialist system, it's the government's role to determine output and pricing levels. The challenge is synchronizing these decisions with the needs of consumers.

The diagram below provides details about an important historical event which phrase completes the diagram

Answers

Answer:

Grievances of the colonists against britian

Explanation:

They are all things that britian did to the colonsists that was mentioned in the grievances of the declaration of independence.

Why did the idea of Pan-Africanism develop?
A. African Americans were becoming aware of a shared culture with
Africans.
B. African Americans believed that Africans were culturally primitive.
C. African Americans were not spread out throughout the United
States.
D. Racism was declining in the American South, and African
Americans had more political power
SUBMIT

Answers

Answer:

d

Explanation:

Answer: The answer is A

Explanation:

Why do you think Augustus was careful to reward soldiers and reduce the size of the army?

Answers

Answer:

This question says Why do YOU think. It is an opinion question, so you are supposed to say what you think. There is no right or wrong answer in this case.

:)

Describe life in the Soviet Union under totalitarian leader Joseph Stalin

Answers

He killed and that just how it is srry

Which is a reason why General Lee finally surrendered?
General Grant asked for him to surrender.
Union forces had him surrounded.
Jefferson Davis told him to surrender.
He has lost confidence in his soldier's skills.

Answers

He was surrounded by Grant’s forces at Appomattox Courthouse, so it would be “Union forces had him surrounded.”

Robert E. Lee's submission to Ulysses S. Grant on April 9, 1865, ultimately put an end to the Civil War, though other Southern armies would continue to submit until May. It is one of the most significant moments in American history. Hence option B is correct .

What was the reason behind General Lee ?

A week later, on April 9, the Confederate army submitted at Appomattox. The most renowned commander of the Confederacy, Gen. Robert E. Lee, merely handed over his Army of Northern Virginia to Union Gen. Ulysses S. Grant, even though it was the most momentous surrender to occur throughout the Civil War.

Lee made the decision to hand over his forces in part to spare the South needless damage. Lee noted that the Confederates realized they were overstretched and unable to penetrate the Union lines. "I have no choice but to visit Gen.

Appomattox County, Virginia | April 9, 1865. The deadliest struggle in American history came to an end when Confederate leader Robert E. Lee, who had been captured by the Federals near Appomattox Court House, surrendered his army to Union general Ulysses S. Grant. This action sparked the surrendering of additional Confederate armies.

Learn more about General Lee here

https://brainly.com/question/15195659

# SPJ 2


Features of bartering in ancient Egypt
1.
2.
3.
PLZ HELP

Answers

Answer:

1.While Egyptians did not use currency, they did use a unit of measure that made trading easier.

2.For social ranking, merchants were right under scribes in importance. They were respected.

3. They had fixed prices on their goods so they would know what the goods were worth and what could be traded for them.

Explanation:

In paragraph form, describe the six main points of most creation beliefs. HELPPPP

Answers

Answer:

A creation myth (or cosmogonic myth) is a symbolic narrative of how the world began and how people first came to inhabit it.[2][3] While in popular usage the term myth often refers to false or fanciful stories, formally, it does not imply falsehood. Cultures generally regard their creation myths as true.[4][5] In the society in which it is told, a creation myth is usually regarded as conveying profound truths, metaphorically, symbolically and sometimes in a historical or literal sense.[6][7] They are commonly, although not always, considered cosmogonical myths – that is, they describe the ordering of the cosmos from a state of chaos or amorphousness.[8]

Creation myths often share a number of features. They often are considered sacred accounts and can be found in nearly all known religious traditions.[9] They are all stories with a plot and characters who are either deities, human-like figures, or animals, who often speak and transform easily.[10] They are often set in a dim and nonspecific past that historian of religion Mircea Eliade termed in illo tempore ("at that time").[9][11] Creation myths address questions deeply meaningful to the society that shares them, revealing their central worldview and the framework for the self-identity of the culture and individual in a universal context.[12]

Creation myths develop in oral traditions and therefore typically have multiple versions;[3] found throughout human culture, they are the most common form of myth.[6]

Explanation:

marking brainliest!!

Answers

B is the answer you are looking for

Answer:

colectove sucuratey

Explanation:

b. Identify and explain ONE event or group that would be supportive of the sentiment expressed in the two cartoons.​

Answers

A group that would most likely be supportive of the cartoon are (I'm assuming) the farmers who plowed the lands everyday yo receive very little in return. During the timeframe of the cartoon Ulysses S. Grant was president and also led the north to victory in the civil war.

How does the representation of women in government impact society?

Answers

Answer:

women empowerment

Explanation:

2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?

Please I need help!

Answers

Answer:

ok

Explanation:

The above items are MOST CLOSELY associated with which of the following?
A. building of the Erie Canal
B. rise of organized labor
C. decline of the Plains Indians
D. northern migration of African Americans

Answers

What??what really is the question

Answer:

decline of the plain Indians

Explanation:

if your question is like mine

the homestead act would have taken their land

completion of the railroad, the railroad was built on their land so...

and mass killing the buffalo just took away their food source

BREAKING NEWS.

A projection has been made, President Donald Trump will win the State of Alaska, he will win all 3 of it's electoral votes.

Answers

Answer:

Biden won already?

Explanation:

and yes electoral votes work like that for each state ;-;

What allowed the Safavid empire to successfully defeat the Uzbeks in 1528?

a
using Janissary-like tactics and weapons
b
Using Janissary-like tactics and bombs
c
Using firearms and artillery
d
Using Janissary-like tactics

Answers

B using janissary like tactics and bombs
C is your answer to the question

What did Europeans do as they established colonies in the Americas?
A. Allowed local tribal chiefs to administrate a central bureaucracy
B. Pursued peace treaties with native peoples immediately
C. Sought out lands that were empty so they would not disturb indigenous peoples
D. Attempted to convert indigenous peoples to Christianity

Answers

Answer:

D. Attempted to convert indigenous peoples to Christianity

Explanation:

PENN

Attempted to convert indigenous peoples to Christianity did Europeans do as they established colonies in the Americas. The correct option is D.

Why did Europeans want to spread Christianity beyond Europe?

Europeans want to spread Christianity throughout the Americas because they thought God wanted them to win over other nations. It is a relatively recent idea that all human cultures are important and have integrity. Since the early 20th century, anthropologists have advised us to make an effort to understand each society according to its own set of rules.

One justification used by European powers to colonize and oppress Africa was Christianity. European countries like Great Britain, France, and the Netherlands aimed to educate and reform African culture through the spread of Christian doctrine.

Thus, the ideal selection is option D.

Learn more about Europeans here:

https://brainly.com/question/1683533

#SPJ2

PLEASE HURRY. FOR 65 POINTS 1. What was the Marshall Court’s role in shaping the balance of power in government and the development of constitutional interpretation? 2. What roles did the presidencies of Thomas Jefferson and Andrew Jackson have in shaping American politics and identity? 3. How did the Industrial Revolution affect labor, social structures, and economic development? Did the changes result in greater prosperity or new conflicts? 4. How did republican values shape American life in the areas of the economy, family, politics, and religion? 5. How did the Second Great Awakening influence the growth of social reform movements? Did these developments represent countercultural movements or a reappearance of traditional American beliefs and practices? 6. Although the Atlantic slave trade was abolished in 1809, the number of enslaved persons increased dramatically during the first half of the nineteenth century. What factors contributed to this growth? How did enslaved persons resist slavery?

Answers

Answer:

1. What was the Marshall Court’s role in shaping the balance of power in government and the development of constitutional interpretation? - His influential rulings reshaped American government, making the Supreme Court the final arbiter of constitutional interpretation.

2. What roles did the presidencies of Thomas Jefferson and Andrew Jackson have in shaping American politics and identity?  - Jackson helped establish the Indian removal act, he prevented the nullification act, and was the first presidents who was not rich. Jackson became the leader of the new democratic party, created by himself. Jefferson was the primary draftsman of the u.s. declaration of independence. he stabilized the u.s. economy and defeated pirates from north Africa during the Barbary war.

3. How did the Industrial Revolution affect labor, social structures, and economic development? Did the changes result in greater prosperity or new conflicts? -  the industrial revolution increased wealth, the production of goods, and the standard of living. people had access to healthier diets, better housing, and cheaper goods. education was also better for children. but the working conditions were bad during the industrial revolution.  as factories were being built, they were looking for workers. with many workers, the wages were very low.

4. How did republican values shape American life in the areas of the economy, family, politics, and religion? - republican - American republicanism was articulated and first practiced by the Founding Fathers in the 18th century. For them, "republicanism represented more than a particular form of government. It was a way of life, a core ideology, an uncompromising commitment to liberty, and a total rejection of aristocracy."

5. How did the Second Great Awakening influence the growth of social reform movements? Did these developments represent countercultural movements or a reappearance of traditional American beliefs and practices? - the second great awakening thought that every person could be saved through revivals, repentance and conservation. it also stimulated the establishment of many reform movements.  

6. Although the Atlantic slave trade was abolished in 1809, the number of enslaved persons increased dramatically during the first half of the nineteenth century. What factors contributed to this growth? How did enslaved persons resist slavery? - factors that contributed to the growth in slavery was the invention of the cotton gin. the cotton gin was successful in the south, so this gave plantation owners more land to farm which increased the slave population. slaves in the plantains resisted slavers by running away, purposely slowed down the work so that they got less one. they also broke tools that they used to work.

Explanation:

sorry for not having the best answers : 0

As a result of his significant decisions, the Supreme Court is now the last arbitrator of constitutional interpretation in the United States.

What was the growth of America ?

2. Jackson was the first president who was not wealthy and helped create the Indian Removal Act. He also stopped the nullification Act. Jackson rose to the position of party leader for the newly founded democratic party.

The main draftsman of the American Declaration of Independence was Jefferson. During the Barbary war, he helped to strengthen the American economy and exterminated pirates from North Africa.

3. The wealth, output, and living standards all rose as a result of the industrial revolution. There were more affordable items, greater housing options, and access to healthier foods. For kids, schooling was also excellent.

However, the industrial revolution was characterized by poor working conditions. factories were constructed ,They were seeking employees. The pay was quite low because there were so many workers.

4. - Republican - In the 18th century, the Founding Fathers first developed and applied the American republican philosophy. Theirs is "Republicanism was more than just a certain political system. It was a way of life, a fundamental belief system, an unwavering dedication to liberty, and an outright rejection of aristocracy."

5. The second great awakening held that revivals, repentance, and conservation could save everyone. Additionally, it sparked the formation of other reform movements.

6. - The development of the cotton gin was a role in the expansion of slavery. Because the cotton gin was effective in the South, plantation owners had access to additional area for farming, which led to a rise in the number of slaves.

Learn more about Republican Values here

https://brainly.com/question/24231882

# SPJ 3

Which was a characteristic of many African nations after their independence

Answers

Answer: They got treated like everyone else as they should have been years ago

Explanation:


With powerful computer-based microscopes, scientists can now determine both the location and speed of
electron at any point in time.
True or false
PLEASE HELP

Answers

Answer:

it is

Explanation:

Explain one similarity and one difference between the Indus River Valley and Ancient China?

Answers

Answer:

ndus Valley Civilization

State-Building

Not much is known about the Indus Valley city governments.

There is evidence of a central government through city planning and similar layouts of all of the cities in this civilization.

Rajahs and Indus Priests were in charge of the government.

Geography

This civilization was twice the size of Texas.

Harrappa and Mohenjodaro were the main cities.

These cities are in present day Pakistan.

More Geography

Arid climate

Temperature Ranges from 32-100 degrees Fahrenheit

Rainfall ranges from 5" to 20"

People depend on Indus River and Asian Monsoons.

Technology and Interactions

Standardized weights, measures, architectural styles and sizes of bricks

The land was very fertile but this was a big risk for disease.

Culture

There were no palaces, temples, elaborate graves, kings or a warrior class.

Ceremonial bathing, ritual burning and yoga positions were part of the Indus Valley Culture.

The language of the Indus Valley Civilization has not been deciphered yet.

Religion was a big part of how the cities were operated. Religion was involved in government because the priests were involved in government.

Agriculture

The economic foundation of the Indus Valley Civilization was their irrigated agriculture.

These people domesticated animals such as pigs, horses and camels.

They harvested crops like cotton, sesame, peas, barley, wheat and rice.

Trade was extensive within the merchant class. Cities traded with each other and with other regions.

There was a big dock in which sea-going ships could trade with other areas like Persia, Southern India and Afghanistan.

Ancient China

State-Building

Chinese rulers, called emperors, based their government on the Confucian model, this was led by example.

Legalists stressed strength, not goodness, as a ruler's greatest virtue.

Daoists rejected the everyday world, and believed that government was better when it was governed the least.

The Great Wall of China was built by Shi Huangdi, The Great Wall is a political structure.

What part of the Constitution spells out how to change the Constitution? Is change easy? Explain.

Answers

Answer:

Article v the part of the Constitution that spells out how to amend that document.

Explanation:

The amendment process is very difficult and time consuming: A new amendment they want to add   has to  be passed by two-thirds of both houses of Congress, and then they ratified by the legislatures of three-fourths of the states.

Dealing with economic issues was the most important contribution made by the Quaid-e-Azam as the first Governor General of Pakistan." Do you agree? Give reasons for your answer.

Answers

Answer:

I do not agree.

Explanation:

It is undeniable that Quaid-e-Azam was a great leader and that he was extremely important for the Pakistani economy, but I do not believe that this is his greatest legacy as Pakistan's first governor-general.

For me, the biggest thing about Quaid-e-Azam was diplomacy and the handling of social issues. He was one of the main responsible for the establishment of the rights of Muslims, for the respect for Muslims in the region where he was and for the establishment of diplomatic relations that were extremely important to the country.

In the mid-1300s, John Wycliffe was

a critic of the Protestant Church.
a reverend in the Protestant Church.
a critic of the Catholic Church.
a leader in the Catholic Church.

Answers

Answer:

answer C

Explanation:

A critic of the catholic church

In the mid-1300s, John Wycliffe was:

C. A critic of the Catholic Church.

According to the given question, we are asked to show the thing which John Wycliffe was most known for in America during the period of the mid-1300s.

As a result of this, we can see that John Wycliffe was known as a critic of the Catholic Church in the mid 1300s as he spoke against the various doctrines and dogmas which were practised by the Roman Catholic Church.

Therefore, the correct answer is option C

Read more about John Wycliffe here:

https://brainly.com/question/298030

Someone please help will mark as brainliest

Answers

Answer:

Irish Families Immigrated to the United States.

Explanation:

I took the quiz.

Other Questions
(8,9), X + 8y = 9Help me please What is 15% of 140? A.2,100 B.30 C.21 D.119 What was a vassal required to pay to their lord? crops money land tares Helppp ASAP. Emma wants to enlarge a square photo and print it to a square canvas. The sidelength of the canvas is 12 in. The scale from the canvas to the photo is 4 in. to 1 in.What is the side length of Emma's photo? Show your work. What other story element is most affected by the narrator's point of view?A) the story's titleB) the story's settingC) the story's theme Express the recurring decimal 0.56 (Just the 6 is recurring) in its simplest form. What should you ask yourself before you post a photo, video, or other information about another person online? 1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD PLZZ ANSWER THE QUESTION What point of view is the poem "The Song of the Storm -- Spirits" written in? The top of the saturated zone is known as A. the aquifer B. the water table C. the unsaturated zone D. spring rock How could you explain why soap is able to clean the oil and dirt off your bodies? Which of the following would be considered a derived unit? A) length B mass C) density D) temperature La hermana de mi hermana es mi ________. find y when y = 3x^2 -2x+5 and x = -1