Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

Answers

Answer 1

Anwser: Methionine-Proline-Glutamate.

Answer 2

The chain of amino acids would be produced by the given sequence of mRNA is as follows:

Tyr-Tyr-Ala, Val-Asn-Cys.

What do you mean by Amino acids?

Amino acids may be defined as the building blocks or monomers of proteins. They usually consist of an amino group, a carboxyl group, a hydrogen atom, and a distinctive side chain. These monomers are held together by peptide bonds in order to make a protein.

The codon UAU codes for the amino acid tyrosine. While the codon GCC codes for the amino acid alanine. There are three stop codons that terminate the synthesis of proteins. They are UAA, UGA, and UAG. While the codons GUG, AAU, and UGC encode for valine, asparagine, and cysteine.

Therefore, the chain of amino acids would be produced by the given sequence of mRNA is well described above.

To learn more about Amino acids, refer to the link:

https://brainly.com/question/14351754

#SPJ2


Related Questions

a type of bacteria doubles every (t) hours, and we will begin a culture with 10 bacteria. give the function that expresses the amount of bacteria b there will be after t hours

Answers

A type of bacteria doubles every (n) hours, and we will begin a culture with 10 bacteria. The amount of bacteria there will be after n hours will be: Y = 10* e²ᵇ

We must simulate the behavior of a function for use in practical applications. In mathematical modeling, we pick a well-known general function with characteristics that imply that it will model the actual phenomenon we want to study. When growth is brisk, we can pick the exponential growth function:

    Y=  A₀* eᵇⁿ

      Y = 10* e²ᵇ

where,  A₀ denotes the value at time zero that is initial number of bacteria, (e) denotes the Euler constant, and b is a positive constant that establishes the growth rate (%). Applications involving doubling time, or the time it takes for a number to double (n) , can be solved using the exponential growth function. Wildlife populations, investments, biological samples, and natural resources are examples of phenomena that can grow based on a doubling time.

To learn more about exponential growth function visit;

https://brainly.com/question/11487261

#SPJ4

is marfan syndrome caused by a substitution, insertion, or deletion mutationin the fbn1 gene

Answers

Marfan syndrome has been linked to deletions or errors in the fibrillin-1 (FBN1) gene (pathogenic variations).

What is Marfan syndrome?

One defective copy of the Marfan gene inherited from one parent is all that is required to have Marfan syndrome, which is inherited as an autosomal dominant characteristic.

The remaining mutations in the FBN1 gene lead to an aberrant fibrillin-1 protein that is dysfunctional.

Therefore, the fibrillin-1 protein undergoes most of the mutations that result in Marfan syndrome by a single amino acid change.

Learn more about the FBN1 gene, here:

https://brainly.com/question/28084069

#SPJ1

which of the following crosses will not produce offspring with the recessive phenotype? select all that apply. a.tt x tt b.tt x tt c.tt x tt tt x tt d.tt x tt

Answers

The answer is (C). TTxTt, the other crosses will produce at least one offspring of recessive phenotype.

Punnett squares must be drawn in order to determine the probability and what happens to all the children.

The dominant trait is denoted by T, and the recessive by t.

TT x tt = Tt Tt Tt Tt = 100% Tt

The dominant allele will be present in every single offspring.

Tt x Tt = TT Tt tT tt =25% TT 50% Tt 25% tt

In this case, there is a 25% chance that the progeny will carry the recessive allele.

TT x TT = TT TT TT TT= 100% TT

The dominant allele will be present in every single offspring.

Tt x tt = Tt tt tt tt = 25% Tt 75% tt

In this case, there is a 75% likelihood that the progeny will carry the recessive allele. Thus TT x Tt will have the recessive phenotype in the offspring.

To learn more about recessive phenotype please click on the given link: https://brainly.com/question/13143211

The correct question is:

Which of the following will not produce offspring with the recessive phenotype?

Select one:

a. tt x tt

b. Tt x tt

c. TT x Tt

d. Tt x Tt

#SPJ4

if two cells have different scaffolding proteins, explain how they might behave differently in response to the same signaling molecule.

Answers

If two cells have different Scaffolding proteins, they handle molecular elements of signaling pathways together in a complex. Various Scaffolding proteins would combine afferent protein collections, resulting in distinct cellular responses in the two cells.

Scaffolding proteins, as the name suggests, combine two or even more proteins in a comparatively stabilized configuration. There are numerous Scaffolding proteins found in nature, many of which have multiple protein-protein interaction modules.

The influence of a chromosome on Scaffold comprising non-histone proteins, known as Scaffolding proteins, has been the most significant structural discovery.

the proteins in a signaling pathway that connect with multiple cells. Based on the results of the analysis, 212 proteins were identified as Scaffolding proteins with statistical importance.

For more information on Scaffolding proteins, visit :

https://brainly.com/question/7951942

#SPJ4

T/ F
The all-or-none phenomenon as applied to nerve conduction states that the whole nerve cell must be stimulated for conduction to take place.

Answers

The all-or-none phenomenon as applied to nerve conduction states that the whole nerve cell must be stimulated for conduction to take place. Reflexes are rapid, automatic responses to stimuli. Efferent nerve fibers may be described as motor nerve fibers.

Happy Holidays!!

the ability to wiggle your ears is an autosomal recessive trait that does not appear to benefit or harm the people who possess the trait. What is the genotypic ratio

Answers

The ability to wiggle the ears is an autosomal recessive trait that does not appear to benefit or harm the people who possess the trait, and the genotype is ee. E is taken for the ear.

What is the recessive trait?

A recessive trait is expressed when two recessive alleles are present together, and in the case of an autosomal recessive trait, there are equal chances of inheritance and character expression in both males and females. In a recessive trait for the wiggle ear, the "E" is taken to represent, so the genotype is "ee," and this trait does not harm the person who inherits it.

Hence, this autosomal recessive trait is expressed as ee.

Learn more about the recessive trait here.

https://brainly.com/question/17447924

#SPJ1

Question: What effect does the water temperature have on solution rate? Make a Hypothesis:

Answers

Answer:

Explanation:

Due to the higher energy of motion of the particles, a solute dissolves more quickly in a warmer solvent than it does in a colder one. Another element that influences how quickly a solute dissolves is the temperature of the solvent. The pill will dissolve more quickly if it is dissolved in warm water because some chemicals dissolve more quickly when the temperature is raised.

Which two sets of changes are most likely to cause a population to remain stable? • A. Increased births and decreased immigration B. Increased deaths and decreased immigration • C. Increased births and increased deaths • D. Increased emigration and decreased births

PLEASE ANSWER THIS IS FOR MY FINAL EXAM
THANK YOU

Answers

Answer:

A population is considered stable when the number of births and deaths is roughly equal, and the number of individuals entering and leaving the population is also roughly equal. Therefore, the two sets of changes that are most likely to cause a population to remain stable are:

Increased births and increased deaths

Increased emigration and decreased immigration

It is worth noting that a population can also remain stable if there is a balance between the number of individuals entering and leaving the population, regardless of the birth and death rates.

Explanation:

DRAW IT : The graph here shows the pH difference across the inner mitochondrial membrane over time in an active respiring cell. At the time indicated by the vertical arrow, a metabolic poison is added that specifically and completely inhibits all function of mitochondrial ATP synthase. Draw what you would expect to see for the rest of the graphed line, and explain graph.

Answers

When an ATP synthase is inhibited by a metabolic poison, the H+ concentration in the mitochondrial membrane rises, lowering the pH. As a result, the graphed line decreases gradually, indicating that pH decreases over time.

H+ would be pumped across the membrane into the intermembranous space, increasing the pH difference between the matrix and the intermembranous space. Because H+ cannot flow back through ATP synthase because the enzyme is constricted by the poison, the difference across the membrane will continue to increase rather than remain constant. Eventually, the concentration of H+ in the intermembranous space would become so high that no more H+ could be pumped against the gradient.

For more information on ATP synthase , visit:

https://brainly.com/question/1906658

#SPJ4

- Most incidental motions:
may be debated after they are amended.
are always debatable.
are not debatable
may be debated if permission is granted.

Answers

Answer:

are always debatable.

In order for something to be considered a 16. Living things are based on a u living thing, it must display. of the eight Characteristics of life

Answers

Answer:living?

Explanation:

One year earlier, J. Herbert Taylor's experiments with Vivia faba came to a similar conclusion as this experiment. John Cairns used radioactively-labelled thymidine to explain why heat denaturation in this experiment occurred only with salmon sperm. A density gradient of cesium chloride was used for the ultracentrifugation step in this experiment. This experiment (*) disproved Max Delbruck's dispersive hypothesis. This experiment used E. coli grown on nitrogen-15, followed by growth on
nitrogen-14, and found that three-quarters of the second generation was light. For 10 points, name this experiment that proved DNA replication is semiconservative.

Answers

The Meselson and Stahl Experiment served as a test to demonstrate semiconservative DNA replication. To explore DNA replication, Matthew Meselson and Franklin Stahl performed an experiment in 1958 using the fast-diverging E. coli bacterium.

Who established semiconservative DNA replication?

Mathew Meselson and Franklin Stahl established in 1985 that DNA replication is semi-conservative. They carried out their experiment on Escherichia coli bacteria.

How did the Meselson-Stall experiment demonstrate the semi-conservative nature of DNA replication?

The semiconservative way of DNA replication is indicated by the lighter strand, which is the new one generated from the culture, and the heavier strand, which stands in for the parents. The replication of DNA in this way proved to be semiconservative.

To know more about DNA replication visit:-

https://brainly.com/question/16464230

#SPJ4

shown below are several molecules found in animal cells, along with their mass in daltons. based on the data gathered by loewenstein, et al. which molecule(s) would be excluded from moving through gap-junction channels? molecule approximate mass (daltons) histidine (an amino acid) 100 carnosine (a dipeptide) 226 thyroid-releasing hormone (trh, a peptide hormone) 360 atp 551 insulin (a peptide hormone) 5808 hexokinase (an enzyme) 50,000

Answers

Molecules that would be excluded from moving through gap-junction channels are insulin and hexokinase.

Connexins, a family of proteins articulated for most tissues of an organism, form gap junction channels.

Gap junction channels allow ions and other small molecules to pass between contacting cells, synchronizing them both electrically and metabolically. Gap junction channels are highly specialised intercellular connections that connect a wide variety of animal cell types. They connect the cytoplasm of two cells directly, allowing molecules, ions, and electrical impulses to transfer through a governed gate between cells.

Hexokinase is the first glycolytic enzyme, potentiating the phosphorylation of glucose by ATP to glucose-6-P. It is one of the glycolysis rate-limiting enzymes. As regular red cells age, their activity decreases rapidly.

Insulin is a peptide hormone created by pancreatic islet beta cells and encoded by the INS gene in humans. It is thought to be the body's primary anabolic hormone. Hexokinase is a potential insulin regulatory site that is irregular in insulin resistance. The modified regulation of hexokinase may play a significant role in the diminished insulin-mediated glucose flow rates in insulin-resistant skeletal muscle.

For more information on Gap junction channels, visit :

https://brainly.com/question/10252012

#SPJ4

11. In 1996 the moose population dropped, what then happened to the wolf population in the following
year? Explain why.

Answers

Answer:

Due to the unfortunate loss of the moose population, the wolf population will also drop because primary prey is lost.

Explanation:

When a species becomes extinct or endangered, the life cycle is disarrayed. The butterfly affect is a great example; one factor makes a difference. Without chocolate, there are many recipies one can not make. Without moose, many wolves will starve.

Gastric glands produce _________ and are part of the _______ system.
A. stomach acid, endocrine
B. oily sebum, endocrine
C. oily sebum, exocrine
D. stomach acid, exocrine

Answers

Answer:

Option D

explanation:

Gastric glands produce stomach acid and are part of the exocrine system. The exocrine system is a system of glands that produce and secrete substances directly into ducts that lead to the outside of the body, such as the skin or the digestive tract. Stomach acid is a digestive enzyme that is produced by the gastric glands and secreted into the stomach, where it helps to break down food. Therefore, the correct answer is option D, which states that gastric glands produce stomach acid and are part of the exocrine system.

Why might a scientist use a physical model of a bacterial cell instead of
studying the cell directly?

Answers

Practicality: It may not always be practical or feasible to study a live bacterial cell directly, especially if the cell is difficult to culture or requires special equipment or facilities. In such cases, a physical model can provide a convenient alternative for studying the cell's properties and behavior.Safety: Some bacterial cells can be dangerous or harmful to humans, making it necessary to study them using a physical model that can be handled safely.Control: Physical models allow the scientist to have more control over the conditions under which the cell is studied, such as temperature, humidity, and nutrient availability. This can be useful for understanding how the cell responds to different conditions and for comparing the results of different experiments.Simplicity: A physical model can be simpler and more straightforward to use than a live cell, which can be more complex and variable. This can make it easier for the scientist to focus on specific aspects of the cell's behavior and to interpret the results of the experiment.Cost: Studying live cells can be expensive, especially if specialized equipment or facilities are required. A physical model may be a more cost-effective alternative, especially for research projects with limited budgets.

The artery that bifurcates into the right subclavian artery and the right common carotid artery is the:
O brachiocephalic artery
O right common iliac artery
O right brachial artery
O right coronary artery
O superior vena cava

Answers

The artery that bifurcates into the right subclavian artery and the right common carotid artery is the brachiocephalic artery

The brachiocephalic artery or brachiocephalic trunk is an artery of the mediastinum that supplies blood to the right arm and the head and neck. It is the first branch of the aortic arch. Soon after it emerges, the brachiocephalic artery divides into the right common carotid artery and the right subclavian artery.

There is no brachiocephalic artery for the left side of the body. The left common carotid, and the left subclavian artery, come directly off the aortic arch. However, there are two brachiocephalic veins. The brachiocephalic artery arises, on a level with the upper border of the second right costal cartilage. The function of Brachiocephalic artery is to bring blood from heart to right arm, head, and neck.

learn more about Brachiocephalic Artery:

https://brainly.com/question/29512345

#SPJ4

What is the speed of a wave if it has a wavelength of 12 m and a frequency of 3 hertz?

Answers

Answer:

The speed of a wave is 36 m/s

Explanation:

Given;Wavelength (λ) = 12 mFrequency (f) = 3 Hz or s⁻¹To Find;Speed (v)

So,

v = λ × f

v = 12 × 3

v = 36 m/s

Thus, The speed of a wave is 36 m/s

Imagine you are a paleontologist trying to find the “missing link” between different species. In three to five sentences, create a fictional narrative about your discoveries, describing: 1) what two species, mythical or real, you are studying, 2) what evidence you have linking these species, and 3) what evidence you have to define different correlations and causations that support your hypothesis.

Answers

As a paleontologist, I am studying the mythical griffin and the real-life tyrannosaurus rex. I have found fossil evidence that suggests that the griffin and the T-rex are closely related, such as their similar bone structure and tooth patterns. I also have evidence of their common ancestors, such as the presence of feathers on both species. My hypothesis is that the griffin evolved from the T-rex through a process of natural selection and adaptation to their environment. Further research is needed to confirm the exact nature of their relationship and the specific causations that led to the evolution of the griffin.

All of the following tools should be used to remove a hair sample from an object except
Osticky tape
tweezers
vacuum
Obrush

Answers

Brush are not used , Hair samples are primarily collected using tools tweezers, trace tapes, and vacuuming. Other methods of hair sample collection include combing and clipping methods.

What methods are employed in the forensic examination of hair?

Three main types of hair analysis are conducted by forensic scientists: (1) testing the hair shaft for drugs or nutritional deficiencies in an individual's system; (2) analyzing DNA extracted from the root of the hair; and (3) examining hair under a microscope to determine whether it is from an individual or an animal.

How are hair samples collected?

A hair drug test, commonly referred to as a hair follicle drug test, looks for both illicit drug use and prescription drug abuse, a little section of hair cut off of your head for this test. After that, the sample is examined for evidence of drug usage in the 90 days prior to the test.

Learn more about DNA here:

https://brainly.com/question/14315652

#SPJ1

The processes illustrated in the models depicted above all result in which of the following?
A) Transcription
B) An increase in genetic variation
C) horizontal gene transfer
D) an increase in the chromosome number

Answers

The process illustrated in the figure shows an increase in genetic variation.

The true choice is B

Genetic variation is a variation that occurs in the genome of an organism either in nucleotide bases, genes, or chromosomes. Genetic variation at the basic level is shown by differences in the base sequences of the nucleotides (adenine, thymine, guanine, and cytosine) that make up DNA in cells.

Genetic variation can be caused by several events, namely crossing over, conjugation, mutation, and fertilization. Genetic variation can be one of the factors that influence evolution.

Genetic variation is very influential in evolution because the greater the genetic variation in a population, the greater the chance for that population to adapt to environmental changes and disease.

Learn more about genetic variation at https://brainly.com/question/14926046

#SPJ4

Assuming no gene linkage, in a dihybrid cross of AABB x aabb with AaBb F1 heterozygotes, what is the ratio of the F1 gametes (AB, aB, Ab, ab) that will give rise to the F2 offspring?a.1:1:1:1b.1:3:3:1c.1:2:2:1d.4:3:2:1

Answers

Assuming no gene linkage, in a dihybrid cross of AABB x aabb with AaBb F1 heterozygotes, the ratio of the F1 gametes (AB, aB, Ab, ab) that will give rise to the F2 offspring is 1:1:1:1.

Gene linkage is the proclivity of genes or segments of DNA closely located somewhere along chromosomes to segregate together during meiosis and thus be inherited together.

Gene linkage evaluation is an effective method for determining the chromosomal position of disease genes. It is based on the discovery that genes that are physically close to one another on a chromosome stay connected during meiosis.

Genes that are close enough together on a chromosome will often seem to "stick together," and the variants (alleles) of those genes that are close together on a chromosome will more often than not be inherited as a pair. This is known as genetic linkage or gene linkage.

For more information on Gene linkage, visit ;

https://brainly.com/question/14949577

#SPJ4

the distribution of heights of adult men is approximately normal with a mean of inches and a standard deviation of inches. bob's height has a -score of when compared to all adult men. which of the following is true?

Answers

Answer: Bob is shorter than 69 inches tall

Explanation:

1. I took the quiz and 2. Bob's height has a Z-score of -0.5 when compared to all adult men.

Artificial selection (chosen by person) and natural selection (best changed in the environment) differ in one major way- the forces that select which organisms are able to survive and reproduce. How are these processes different?

a. In natural selection, the organisms best adapted to survive in the environment are more likely to reproduce and pass on their traits, while in artificial selection, humans choose which organisms survive and reproduce.
b. In natural selection, humans choose which organisms survive and reproduce, while in artificial selection, the organisms best adapted to survive in the environment are more likely to reproduce and pass on their traits.
c. In natural selection, both the humans and the environment choose which organisms survive and reproduce, while in artificial selection technology chooses which organisms survive and reproduce.
d. In natural selection, technology chooses which organisms survive and reproduce, while in artificial selection, humans and the environment choose which organisms survive and reproduce.

I think it is A, but I believe two heads are better than one. So, check my answer pelase

Answers

The way that the processes of artificial and natural selection are different are:  a. In natural selection, the organisms best adapted to survive in the environment are more likely to reproduce and pass on their traits, while in artificial selection, humans choose which organisms survive and reproduce. Option A

What is meant by artificial selection?

Individual organisms with certain phenotypic characteristic values are chosen for breeding through a method called artificial selection. If the chosen characteristic exhibits additive genetic variation, it will respond to selection and change over time.

Because humans (rather than nature) choose which creatures get to reproduce, this process is referred to as artificial selection. The image below demonstrates how farmers have artificially selected for certain traits to develop several crops from wild mustard.

Artificial selection is directed by human preferences and differs from natural selection in that it is not random.

Read more on artificial selection here: https://brainly.com/question/27357782

#SPJ1

TRUE/FALSE. indoor air pollution receives less attention than outdoor air pollution, yet it exerts severe health impacts on millions of people. poverty worsens indoor air pollution in the developing world; high-technology products and chemicals contribute to it in the developed world; and certain lifestyle choices can affect all of us. fortunately, many solutions are within reach to address the causes and lessen the consequences of this environmental health risk.

Answers

True. Indoor air pollution receives less attention than outdoor air pollution, yet it exerts severe health impacts on millions of people.

Air pollution is defined as pollutants of the indoor or outdoor surroundings by any chemical, physical, or biological agent that alters the natural properties of the atmosphere. Common sources of air pollution include household combustion devices, motor vehicles, industrial facilities, and forest fires.

The primary sources of man-made air pollution are vehicle emissions, fuel oils and natural gas used to heat homes, byproducts of industrial production and electricity production, primarily coal-fueled power stations, and fumes from chemical production.

Air pollution is defined as contamination of the indoor or outdoor environment by any chemical, physical, or biological agent that alters the natural characteristics of the atmosphere. Household combustion devices, motor vehicles, industrial facilities, and forest fires are all common sources of air pollution.

Vehicle emissions, fuel oils and natural gas used to heat homes, byproducts of industrial production and power production, especially coal-fueled power plants, and fumes from chemical products are the primary sources of man-made air pollution.

The air pollution sources are numerous. Residential energy for preparing food and heating, automobiles, power generation, agriculture/waste incineration, and industry are the major outdoor pollution sources.

For more information on Air pollution, visit :

https://brainly.com/question/21683809

#SPJ4

Help help help please help help me 50 points for right answer

Identify the components of protein synthesis in this image. (One of these will not be used .)

Answers

In protein synthesis, 1. Ribosomes, 2. tRNA, 3. Amino acids and 4. mRNA.

What do you mean by protein synthesis?

Protein synthesis is the creation of proteins by cells that uses DNA, RNA, and various enzymes. It generally includes transcription, translation, and post-translational events, such as protein folding, modifications, and proteolysis.

Moreover, protein synthesis represents the major route of disposal of amino acids. Amino acids are activated by binding to specific molecules of transfer RNA and assembled by ribosomes into a sequence.

Protein synthesis is a vital process because we need our bodies to be able to build the proteins that we need to perform important functions.

Learn more about protein synthesis:

https://brainly.com/question/29765585

#SPJ1

Smooth ER makes ___________ and performs other ________________. It also ______________ poisons. It does not have __________ so it does not make _____________.

Answers

The generation of lipids and steroids is one of the many cellular processes carried out by the smooth endoplasmic reticulum.

What does the fluid ER produce? The generation of lipids and steroids is one of the many cellular processes carried out by the smooth endoplasmic reticulum.Additionally, it is essential to the detoxification of toxins, drugs, and alcohol.Blood detoxification is largely accomplished by liver cells.The Smooth Endoplasmic Reticulum's functions.The creation of lipids like cholesterol and phospholipids, which make up all of the membranes of the organism, depends on the smooth ER.Additionally, it plays a crucial role in the production and secretion of steroid hormones from lipid precursors like cholesterol.Animal liver cells also have a large number of smooth ER units.The organelle has a unique role in these cells.Enzymes are used in this instance by smooth ER to aid the liver's detoxification process.These enzymes disintegrate harmful substances, notably alcohol's ethanol.

To learn more about endoplasmic reticulum refer

https://brainly.com/question/18907185

#SPJ1

Things like your eye color and height are not under your control. This is because they are determined by your genes.
So, eye color is a good example of an inherited
A
height
Bestate
C carbohydrate
D
trait

Answers

A trait that is inherited is the color of the eyes. Both height and eye color are qualities that are influenced by multiple genes.

Which gene affects eye color?

ASIP, IRF4, SLC24A4, SLC24A5, SLC45A2, TPCN2, TYR, and TYRP1 are among the genes with known effects on eye color. There is probably a continuum of eye hues in different persons due to the interactions between these genes, OCA2, and HERC2.

Exactly one gene determines eye color?

Brown eyes are more prevalent than blue eyes, and eye color has historically been thought of as a single gene feature. At least eight genes have been found to affect the ultimate color of eyes, according to current research. Melanin levels in the specialized iris cells are regulated by genes.

To know more about inherited trait visit :-

https://brainly.com/question/4520267

#SPJ1

Could the biological, psychological, and sociocultural factors behind psychological disorders all be correct, or is there only one factor that dominates

Answers

In psychological disorders, the biological, psychological, and sociocultural factors are all correct.

What are psychological disorders?

Psychological disorders are disorders that affect the thought process of an individual.

Psychological disorders are all a combination of biological, psychological, and sociocultural factors.

The biological factors that are involved include the structure of the body organs especially the brain and other related organs and tissues. For example, when lesions occur in the brain, it could lead to psychological disorders.

Psychological factors are those factors that are not physical factors but affect the mind and emotions.

Sociocultural factors are the environmental factors that affect an individual.

Learn more about psychological disorders at: https://brainly.com/question/983672

#SPJ1

The Humoral immune response is a chain reaction of antigens and Interleukins that results in:
A. The production of macrophages to use phagocytosis on pathogens.
B. The differentiation of helper T cells into cytotoxic T cells to destroy pathogens.
C. The swelling of fluid and clotting elements to a damaged area.
D. The differentiation of effector B cells into plasma cells to make antibodies.

Answers

The Humoral immune response is a chain reaction of antigens and Interleukins that results in: The differentiation of effector B cells into plasma cells to make antibodies.

What is meant by Humoral immune response?Plasma cells release antibody molecules, which are the mediators of the humoral immune response. B cells get signals from antigen that attaches to the B-cell antigen receptor, and at the same time, the internalised antigen is processed into peptides that activate armed helper cells.Innate humoral immunity refers to innate immunity that is protein-based. Examples include the body's complement system, interferon, and interleukin-1 compounds (which causes fever). If an antigen manages to get past these barriers, additional immune system components will attack and eliminate it.Infections within cells are stopped from spreading by the humoral immune response, which also destroys extracellular microbes. The reason humoral immunity is so termed is because it uses components present in bodily fluids or humour.

Learn more about Humoral immune response refer to :

https://brainly.com/question/29557865

#SPJ1

Other Questions
alice plans to speak with her partner in the morning about never having unprotected sex again. she knows that her partner will be readily available to talk then. what method is alice exercising for her sti discussion? A disadvantage of hiring local managers is that they are often unfamiliar with the home country of the IC and with its policies and practices. What are the 3 main themes presented in Of Mice and Men? Which are indicators that economist used to measure how an economy grows? which state arrested large numbers of kkk members in 1923, although the influence of the group was not eliminated? What are the special rights of an accused person in a criminal trial? You are making a coffeetable with a glass top surrounded by a cherry border.The glass is 3 feet by 3 feet. You want the cherry borderto be a uniform width. You have 7 square feet of cherryto make the border. What should the width of the border be? Tell weather the p=6 is a solution of p + 5 < 12 yes or no Marks cost does not vary directly with time spent talking because A graph titled Phone Plan Costs shows Mark's cost and Nikiya's cost and shows Time Spent Talking (hours) on the x-axis and Cost (dollar sign) on the y-axis. A straight line showing Mark's cost starts at (0, 20) and goes through (3, 40). A straight line showing Nikiya's cost starts at (0, 0) and goes through (2, 30). What happened to Clarence Gideon? What is the authors purpose in Silent Spring? In 2008, the u.s. government built on the influential 1996 surgeon general's report with a document titled: _________ Find the Slope of (7,-6) and (2,-3) What are the capabilities of the country in terms of national security? Homeostasis literally means the same or steady state. A plants health depends upon the availability of water, air, light, and nutrients. Which statement BEST describes how plant organelles help the plant to maintain homeostasis? What are the foci of an ellipse orbit? What is the median of 1 2 3 4 5 6 7? What role does the mass media play in the US political system ? kara wants to subscribe to a streaming tv service. she spends a considerable amount of time researching netflix and sling tv. in the end she choses to subscribe to sling tv. now, however, she hears her friends talking about a great series that is only available from netflix and she wonders if she made the right decision. this scenario exemplifies the concept of What is difference between stagflation and inflation?