What are the similarities that all the organisms classified under the family Hominidae share?

Answers

Answer 1

Answer:

Among these adaptations are: streamlined bodies for efficient movement through water; forelimbs modified into flippers to aid in steering; hind limbs internalized remnants reducing drag; tail positioned horizontally to achieve a powerful up and down propulsion; hair replaced with under-skin blubber to provide warmth ...

Explanation:


Related Questions

Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.

Answers

Answer:

Liver phosphorylase a concentration decreases when glucose enters the blood.

The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form

As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form

Explanation:

Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.  

Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks

Answers

Answer:

Bacteria

Explanation:

Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.

Sunlight, rocks, and soil are all non-living.

The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.

They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.

Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.

Learn more about  soil  at:

https://brainly.com/question/31227835

#SPJ6

Select the statement(s) that is accurate about the immune system.

Answers

What’s the statements

Help stepbro im stuck in the washer

Answers

Answer:

I'LL HELP YOU......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................NOT

What is the major distinction scientists use to divide the animal kingdom?

Answers

Answer:

Whether the animal has a vertebral column or not.


"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"

Answers

Answer:

b is the answer my friend. hope this will solve your problem. mark me as brainliest

Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver​

Answers

Answer:

The pancreas

Explanation:

it happens when the pancreas doesnt produce enough of something called insulin

If making a protein was like making a building, then the DNA molecule is like the blueprints and the RNA molecules are like the construction workers
True
False

Answers

I’m pretty sure it’s true. It makes the most sense.

how is zero, oxidation numbers, and noble gases related​

Answers

Of its valence electrons or the no. Of valences in its Valence shell .In case of noble gases, their outermost shell is absolutely crammed so no emptiness is available in the outer maximum shell. Thus the oxidation kingdom is 0(zero)for Noble gases. Because, they've complete electrons in their out maximum shell.

hope this helps

the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles​

Answers

the answer to the question is c

what does the tilde symbol mean in biology

Answers

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".

You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele

Answers

Answer:

Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )

Explanation:

The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.

The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ).  hence option D is the correct answer.

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.


Please help, A, B,C, or D?

Answers

Answer:

I cant see the pic??

Explanation:

how does a liver cell respond to insulin

Answers

Answer:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Explanation:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

How do invasive species usually affect the availability of natural resources in an ecosystem?

PLEASE HELP ME​

Answers

Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

Explanation:

What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%

Answers

Answer:

90%

Explanation:

Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.

Answers

A. He crossed true-breeding pea plants

The research practices Mendel used is applies including A, B and C.

What is Mendel's experiment?

Mendel studied inheritance in peas (Pisum sativum). He chose peas because pea plant are easy to grow and can be sown each year. Pea flowers contain both male and female parts, called stamen and stigma, and can usually self-pollinate.

Mendel studied the inheritance of 7 traits in pea plants including height, flower color, seed color, and seed shape and each trait had 2 forms. He identified pure-breeding pea plants that consistently showed 1 form of a trait after generations of self-pollination.

Mendel proposed a theory of inheritance, based upon the observed data during his experiments, and a mathematical analysis of his results,

Thus, from above, the correct options include A, B and C whereas D doesnt apply because Mendel studied 7 traits at a time.

Learn more about Mendel' experiment, here; https://brainly.com/question/3056662

#SPJ2

How can a small mutation provide a small advantage to an organism?

Answers

Answer:

It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.

Hope this helps!

Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids

Answers

Answer:

The correct answer is - proteins.

Explanation:

All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.

Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.

Describe the steps a plant would take to move sugars from a source to a sink.

Answers

sugars are transported through the phloem, from sources to sinks, is called pressure flow. At the sources (usually the leaves), sugar molecules are moved into the sieve elements (phloem cells) through active transport.

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: *
A. pituitary gland
B. thyroid gland
C. pancreas
D. adrenal gland

Answers

Answer:

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: thyroid gland.

The largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

What do you mean by Endocrine Gland?

An endocrine gland may be defined as a type of gland which consists of several organs that make hormones and release them directly into the blood so they can travel to tissues and organs all over the body. These hormones control many important functions in the body, including growth and development, metabolism, and reproduction.

The pancreas is the largest endocrine gland that significantly makes three hormones namely, Insulin, Glucagon, and Somatostatin. These hormones are actively involved in the regulation of metabolism by numerous mechanisms.

For example, insulin lowers the level of sugar in the blood, while glucagon increases the level of sugar by transforming its storage form.

Therefore, the largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

To learn more about Endocrine glands, refer to the link:

https://brainly.com/question/4455660

#SPJ2

Which factor listed below is abiotic? Bacteria, water, fungi, protists

Answers

Answer:water

Explanation:

Answer:

Water

Explanation:

Water does not contain cells, therefore it is non-living.

How many hydrogen bonds are present in the base pairing of guanine and cytosine?
3

Answers

Answer:

3 Hydrogen bonds

Explanation:

Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds.

Which layer has more density?
Inner Core
Outer Core
Lower Mantle
Upper Mantle

Answers

Answer:

inner core

Explanation:

I looked it up

The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it

Answers

Answer:

A) make new cells(somatic cells)and only germ-line cells do it(meiosis)

Explanation:

Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.

While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.

Meiosis produces germ cells while mitosis produces somatic cells.

Help ASAP, please
Thank you, Friends:)

Answers

irieirirkekeksksekekekekdjdjdjdkdkskdkdjdj

I need help ASAP!!
A.D
B.B
C.C
D.A

Answers

Answer:

a ibecause tifmsndtbeekodfhekekn

Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree

Answers

Answer:

D

Explanation:

The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria

I think it’s a calibrator but I’m not 100% sure he might be right it could be D

The changes that occurred in Yellowstone National Park after all of its wolves
were killed showed that wolves are
A. harmful to the ecosystem
B. the only producers in the ecosystem
C. beneficial to the ecosystem
a
D. unnecessary for the survival of other species

Answers

C. beneficial to the ecosystem
Other Questions
A 25 mL sample of 0.1M NH3 is titrated with 0.1M HCl.Calculate the pH values of the solution after the volumes of 0.1M HCl are added. 0.00mL,5.00mL,10.00mL,15.00mL,20.00mL,22.00mL,24.00mL,25.00mL and 26.00mL. Indicate the oxidation number of phosphorus, iodine, nitrogen, tellurium, and sillicon in the following ions. Remember that the sum of the oxidation numbers for an ion must equal the charge of the ion. PO43- PO33- HPO42- P3O103- IO3- IO2- IO- NH4+ NO2+ NO2- NO- NO3+ N2O22- TeO42- SiO22- Indicate the oxidation number of the metallic element(s) in the following compounds. None of the compounds listed are peroxides. Fe2O3 FeO CoS CoSO4 K3CoCl6 CrCl3 CeO3 K2CrO4 K2Cr2O7 KCrO2 K2MnO4 Mn2O7 MnO2 PbO2 Pb3O4 Zrl4 U3O2 UO2Cl2 Write formulas for all of the compounds resulting from matching all cations with all anions in each set. Remember that the sum of the oxidation numbers for a compound must equal zero. One characteristic of plant assets is that they are long term investment natural resources Fall of the House of Usher, excerptBy Edgar Allan PoeThe room in which I found myself was very large and lofty. The windows were long, narrow, and pointed, and at so vast a distance from the black oaken floor as to be altogether inaccessible from within. Feeble gleams of encrimsoned light made their way through the trellised panes, and served to render sufficiently distinct the more prominent objects around; the eye, however, struggled in vain to reach the remoter angles of the chamber, or the recesses of the vaulted and fretted ceiling. Dark draperies hung upon the walls. The general furniture was profuse, comfortless, antique, and tattered. Many books and musical instruments lay scattered about, but failed to give any vitality to the scene. I felt that I breathed an atmosphere of sorrow. An air of stern, deep, and irredeemable gloom hung over and pervaded all.Read these lines from the text:Dark draperies hung upon the walls. The general furniture was profuse, comfortless, antique, and tattered. Many books and musical instruments lay scattered about, but failed to give any vitality to the scene.Which of the following best summarizes the main message of these lines? What is the most important characteristic feature of modern poetry? What is Squealer's explanation of why pigs must be given special food How do the other animals react? an investor bought investment property at the beach for $35,000 per acre. twenty years later she sold the 100-acre lot to a developer for a profit, and paid $1.05 million in taxes as a result of the sale. if capital gains are taxed at 15% and her marginal tax bracket is 35%, what was the price paid by the developer for the lot? What is scarcity and choice? What is the mean deviation of first 10 even natural numbers A 5 B 5.5 C 10 D 10 5? You are refilling your inventory of welcome packet for new cutomer. For each packet, it take 5 minute to print, 2 minute to organize, and 5 minute to proofread. The ink in the printer will need to be changed every 5 packet, which take 3 minute. You have 3 hour to dedicate to thi tak. Aume thathe ink in the printer wa already changed before beginning and that you have to complete each packet before completing any tep for the next one. How many welcome packet will you be able to fully complete in the time allotted? I NEED HELP FASTA colony of bacteria grows according to the law of inhibited growth. If there were 200 bacteria at noon, and 550 at 2 pm. Determine when the colony will reach a population of 2000.logistic model:[tex]y(t)=\frac{c}{1+ae^-bt}[/tex]I feel like I'm not given enough information. I'll assume that the limit is 10000 What symbol represents Napoleon in Animal Farm? T/F third-order relations between secondary mental abilities are the highest level of the hierarchy of skills regarding the structure of intelligence. NO LINKS!!A deposit pf $6000 is made in a college savings fund that pays 5.0% interest, compounded continuously. The balance will be given to a student after the money has earned interest for 40 years. How much (in dollars) will the student receive? (Round your answer to the nearest cent.) Leccin 10- 1 - Identificar Audio Listen and write each word under the appropriate category in the order you hear it. What is clarity of outcome in agile? if your vehicle skids, take your foot off of the gas pedal, but do not hit the brakes unless you are about to hit something. Rafael has a sleep disorder for which he takes medically prescribed amphetamines. For which of the following sleep disorders is Rafael most likely being treated?a. Sleep apneab. Narcolepsyc. Insomniad. Circadian rhythm sleep disordere. Somnambulism What is one benefit of having a primary care physician? What is the osmolarity of a 20% NaCl solution?