What can be concluded from the graph?
The layers of Earth have different densities.
O P and S waves are absorbed in the core.
The layers of Earth do not have distinct boundaries.
O Pand S waves always originate in the mantle and travel through the core.

What Can Be Concluded From The Graph?The Layers Of Earth Have Different Densities.O P And S Waves Are

Answers

Answer 1

Answer:

Explanation: second option


Related Questions

what is the meaning of eliminated

Answers

Answer:

completely remove or get rid of (something)

Answer:

the act of considering and rejecting each possible choice until only one is left or removing soming. for example in squid games everyone got killed/eliminated at the end but ONLY ONE won.

which one of the following statements is correct? a dna cut into two pieces, leaving short regions of single-stranded dna at the ends. which one of the following statements is correct? a dna cut into two pieces, leaving short regions of single-stranded dna at the ends. if a restriction enzyme is combined with a piece of dna that contains its restriction site, the result will be restriction fragments. if a restriction site is cut with a restriction fragment, the results will be multiple restriction enzymes. if a restriction fragment is cut with a restriction enzyme, even more restriction fragments will be produced. if a restriction enzyme is cut at its restriction site, the result is one or more restriction fragments.

Answers

The restriction enzymes when combined with the DNA containing restriction sites lead to cuts at those sites yielding restriction fragments. The second statement is correct.

The restriction enzymes are the enzymes that recognize specific sites known as restriction sites. These are enzymes that are found in bacteria and this feature is used as a modern biotechnology tool for genetic editing.

There are two ways the ends are formed after the action of a restriction enzyme. It can form blunt ends or sticky ends. The sticky ends have a region at the end that is single-stranded. This region can then join according to the complementary base pairing with another strand having complementary sticky ends.  

If it is assumed that the RE (restriction) enzyme is not interrupted during the generation of restriction fragments, the resulting restriction fragments would not yield more restriction fragments when re-incubated with the RE enzyme.

A restriction enzyme cuts only at restriction sites forming restriction fragments that do not yield more restriction fragments on subsequent action of the restriction enzyme.

In conclusion, the action of restriction enzymes on DNA gives smaller fragments of DNA. The second option is correct.

Learn more about restriction enzymes here:

https://brainly.com/question/28197487

#SPJ12

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

Answers

Anwser: Methionine-Proline-Glutamate.

The chain of amino acids would be produced by the given sequence of mRNA is as follows:

Tyr-Tyr-Ala, Val-Asn-Cys.

What do you mean by Amino acids?

Amino acids may be defined as the building blocks or monomers of proteins. They usually consist of an amino group, a carboxyl group, a hydrogen atom, and a distinctive side chain. These monomers are held together by peptide bonds in order to make a protein.

The codon UAU codes for the amino acid tyrosine. While the codon GCC codes for the amino acid alanine. There are three stop codons that terminate the synthesis of proteins. They are UAA, UGA, and UAG. While the codons GUG, AAU, and UGC encode for valine, asparagine, and cysteine.

Therefore, the chain of amino acids would be produced by the given sequence of mRNA is well described above.

To learn more about Amino acids, refer to the link:

https://brainly.com/question/14351754

#SPJ2

In dogs, gums can be pink - P (dominant), black- B (dominant), and pink with black spots. Write the genotypes for the following phenotypes .

Answers

The possible genotypes for dogs with pink gums would be BB and Bb. The possible genotypes for dogs with black gums would be BB and Bb. The possible genotypes for dogs with pink gums with black spots would be Bb.

In genetics, capital letters are used to represent dominant traits and lowercase letters are used to represent recessive traits. Therefore, in this case, the genotypes for dogs with pink gums would be BB and Bb, the genotypes for dogs with black gums would be BB and Bb, and the genotypes for dogs with pink gums with black spots would be Bb.

For example, a dog with pink gums and black spots could have the genotype Bb, indicating that it has inherited the dominant B allele (black gums) from one parent and the recessive b allele (pink gums) from the other parent. The presence of the pink gums with black spots phenotype indicates that the dog has inherited the b allele from one parent, which causes the pink gums with black spots phenotype to be expressed.

Name the main layers of a tropical rain forest. What kinds of plants grow in each
layer?

Answers

Answer:

Most rainforests are structured in four layers: emergent, canopy, understory, and forest floor.

Give the % yield if 1.78 g of O₂ is produced

%Yield =
Actual Yield/
Theoretical Yield x 100%

%Yield = _________x 100%.

= ____?______ %

Answers

a) The mass of the oxygen is 1.97 g

b) The percent yield is 90.4 %

c) The mass of the oxygen is 1.55 g

What is the percent yield?

We know that the percent yield has to do with the amount of the reactants that has been converted into products in the given reaction. In this case, the reaction that we are dealing with is the decomposition of the potassium oxo chlorate V molecule.

Now we have that;

a) Number of moles of the chlorate = 5 g/122.5 g/mol

= 0.041 moles

If 2 moles of the chlorate produces 3 moles of the oxygen

0.041 moles of the chlorate produces 3 moles * 0.041 moles/ 2 moles

= 0.0615 moles

Mass of the oxygen produced = 0.0615 moles * 32 g/mol

= 1.97 g

b) Percent yield = Actual/Theoretical * 100/1

=  1.78/1.97 * 100/1

= 90.4 %

c) For a percent yield of 78.5% =

Actual = Percent yield * Theoretical /100

= 78.5 * 1.97/100

= 1.55 g

Learn more about theoretical yield:https://brainly.com/question/14966377

#SPJ1

% yield = (1.78 g / theoretical yield) × 100%

To calculate the percent yield, you need to know the actual yield and the theoretical yield of the reaction.

In this case, the actual yield is given as 1.78 g of O₂. The theoretical yield represents the maximum amount of product that can be obtained under ideal conditions.

To calculate the theoretical yield, you need to know the balanced chemical equation for the reaction. Assuming the reaction is complete, the coefficients of the balanced equation can be used to determine the stoichiometry of the reaction.

For example, if the balanced equation is:

2 A + 3 B → 4 C + 2 D

Then, you can use the stoichiometry to find the theoretical yield. Let's say the molar mass of O₂ is 32 g/mol. In this case, we need to calculate the moles of O₂ using the given mass of 1.78 g:

moles of O₂ = mass of O₂ / molar mass of O₂

Next, we need to use the stoichiometry to find the moles of the desired product. Let's assume that O₂ is the limiting reactant and that it is completely converted to the product. From the balanced equation, we can see that 4 moles of C are produced for every 2 moles of O₂:

moles of C = moles of O₂ × (4 moles of C / 2 moles of O₂)

Now that we have the moles of C, we can calculate the theoretical yield of C in grams by multiplying the moles by the molar mass of C.

theoretical yield of C = moles of C × molar mass of C

Finally, we can calculate the percent yield using the formula:

% yield = (actual yield / theoretical yield) × 100%

Substituting the values we calculated:

% yield = (1.78 g / theoretical yield) × 100%

Please note that without the balanced chemical equation and additional information, it is not possible to provide a specific numerical answer for the percent yield.

To learn more about yield, refer below:

https://brainly.com/question/30081101

#SPJ11

The life supporting zone of the earth is *
A) Lithosphere
B) Hydrosphere
C) Atmosphere
D) Biospheres

Answers

Answer:

D

Explanation: Biospheres

A 163163 square-kilometer (km2km2) small island is found 2,000km2,000km from the mainland. A second, larger, 230,000km2230,000km2 island is found 1,000km1,000km from the mainland. Based on the theory of island biogeography, which of the following statements is most likely true about the small island when compared with the large island?

Answers

Based on the theory of island biogeography, the statement that is most likely true about small islands when compared to large islands is that the rate of immigration is lower for small islands than for large islands.

Island theory of biogeography explains differences in species diversity based on island size (for example, large islands tend to have more of a given species category than small islands). This means that the number of species found on an island will be determined by the area of ​​the island.

Island biogeography theory says that small and distant islands support fewer species (types) than large islands close to the mainland. Island occupancy will be a balance of two things:

Colonization of islands by immigrant species. The colonization rate will be high if the island is located near the mainland.The extinction of species on the island. The extinction rate will be higher on a small island because the population is limited, so if a disease becomes a pandemic, the chance of extinction is high. Thus, large islands will have more species, and small islands few species.

The question is multiple choice:

A. The rate of immigration is lower for the small island than for the large island.B. The small island has niches that are more like the mainland than the large island.C. The small island has more available resources than the large island.D. The rate of species extinction is lower on the small island than on the large island.

Learn more about island biogeography theory at https://brainly.com/question/30027682

#SPJ4

What is the overall net gain of ATP in aerobic respiration per one molecule of glucose?
between 0-10
between 10-20
between 30-40
between 40-50

Answers

Overall net gain of ATP in aerobic respiration per one molecule of glucose is between 30-40.

What do you mean by aerobic respiration?

Aerobic respiration is the process of cellular respiration that takes place in the presence of oxygen gas to produce energy from food.

During aerobic cellular respiration, glucose reacts with oxygen, forming ATP that can be used by the cell. Carbon dioxide and water are created as byproducts.

Aerobic respiration provides energy to fuel all cellular processes. The reactions produce ATP, which is then used to power other life-sustaining functions, including growth, repair, and maintenance.

Learn more about aerobic respiration:

https://brainly.com/question/12605249

#SPJ1

1. Cellular respiration is a series of chemical reactions that convert the energy in food molecules into energy stored in the molecule _________. Aerobic respiration requires the presence of Oxygen___________ and releases water and _________________ as waste products.

Answers

Answer:

Cellular respiration is a series of chemical reactions that convert the energy in food molecules into energy stored in the molecule ATP. Aerobic respiration requires the presence of Oxygen and releases water and carbon dioxide as waste products.

Explanation:

we have learned that reliance on culture has increased in the course of human history. yet the fact and mechanisms of evolution remain a key part of our human present and future because

Answers

The reason behind fact and mechanisms of evolution remain a key part of our human present and future is because c) people have not stopped adapting biologically. So, correct option is c

When an animal varieties is adequately dependent on gaining from others for at any rate a few parts of its conduct collection, social developmental cycles can emerge, and these cycles can modify the climate looked by regular determination following up on qualities.

To foster models of social development, we start by taking the hypothetically grounded and exactly tried speculations about our gaining brain science — who individuals gain from and what they will generally deduce while learning — to build models that look at what happens when bunches of people are learning in these ways, and communicating over ages.

On account of their devotion and recurrence of purpose, human social abilities to learn are most likely one of a kind in leading to combined social development, the cycle through which learning collects fruitful changes and fortunate blunders over ages

Hence, correct option is c

To know more about culture, visit here:

https://brainly.com/question/12678729

#SPJ4

(Complete question) is:

We have learned that reliance on culture has increased in the course of human history. Yet the fact and mechanisms of evolution remain a key part of our human present and future because

A.

they provide the clues to building a better human race by promoting directed speciation.

B.

the pace of evolution has been continuously increasing, as human cultural solutions have not been able to keep up with environmental changes such as global warming.

C.

people haven't stopped adapting biologically.

D.

they continue to justify anthropology's biocultural perspective.

E.

they determine, at the genetic level, our phenotype.

Define the following terms: catabolism, anabolism, metabolism, glucose, glycolysis, glycogen, glycogenesis, glycogenolysis, gluconeogenesis, lipolysis, lipogenesis

Answers

Catabolism: The breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.

Anabolism: the synthesis of complex molecules in living organisms from simpler ones together with the storage of energy; constructive metabolism.

Metabolism: Metabolism is the process by which the body changes food and drink into energy. During this process, calories in food and drinks mix with oxygen to make the energy the body needs. Even at rest, a body needs energy for all it does.

Glucose: a simple sugar which is an important energy source in living organisms and is a component of many carbohydrates.

Glycolysis: Glycolysis is the first step in the breakdown of glucose to extract energy for cellular metabolism. Glycolysis consists of an energy-requiring phase followed by an energy-releasing phase.

Glycogen: Glycogen is the stored form of glucose that's made up of many connected glucose molecules.

Glycogenesis: The formation of glycogen from sugar.

Glycogenolysis: Glycogenolysis is the biochemical pathway in which glycogen breaks down into glucose-1-phosphate and glucose. The reaction takes place in the hepatocytes and the myocytes. The process is under the regulation of two key enzymes: phosphorylase kinase and glycogen phosphorylase.

Gluconeogenesis: Gluconeogenesis is a process that transforms non-carbohydrate substrates (such as lactate, amino acids, and glycerol) into glucose.

Lipolysis: the breakdown of fats and other lipids by hydrolysis to release fatty acids.

Lipogenesis: lipogenesis is the conversion of fatty acids and glycerol into fats, or a metabolic process through which acetyl-CoA is converted to.

Mutational signatures of p53 are shown in the figure (G.P. Pfeifer et al., Nature, 21(48), 2002) for the three types of cancer with the highest death rates in the United States: lung (~225,000 deaths in 2016), breast (246,000), and colorectal (381,000).


As shown under each graph in the figure, particular transversions (replacement of a pyrimidine by a purine of vice versa) or transitions (replacement of a purine or pyrimidine by the alternative purine or pyrimidine) are features of specific mutational signatures.

Based on these data, identify the transversion or transition that seems to be induced by cigarette smoke.

Answers

The transversion or transition that seems to be induced by cigarette smoke is due to tranversions.

What is the result of mutation?

A mutation has been known as the result of the changes in the structure of a gene, these variations would be happened in the nucleotide sequence of the genome, and it can be as the consequence of DNA damage.

One type of the DNA mutation has the substitution of one base pair for another. Two type of the substitutions that could be happened. One of them are the transversions, which are interchanges of a purine (A or G) for a pyrimidine (C or T) and vice versa.

Therefore, The transversion or transition that seems to be induced by cigarette smoke is due to tranversions.

Learn more about tranversions on:

https://brainly.com/question/14314137

#SPJ1

A student wanted to find out how temperature might affect the germination of seeds.
(1) What is the variable that should be changed?
(2) What is the variable that should be measured?
(3) What are the 3 important variables that should be kept constant?

Answers

Answer:

(1) The variable that should be changed is the temperature.

(2) The variable that should be measured is the germination rate of the seeds.

(3) The 3 important variables that should be kept constant are the type of seeds, the amount of water, and the amount of light. In order to isolate the effect of temperature on seed germination, it is important to keep these other variables constant so that they do not affect the results of the experiment.

research on aging suggests that as cells age, their rate of cell division decreases until they ultimately no longer divide. which of the following would provide evidence that the decreased rate of cell division is a cellular response related to cell signaling? decreased numbers of cytoplasmic ribosomes decreased affinity of growth factor receptors for their respective ligands decreased hormone production in aged cells decreased atp production in aged cells

Answers

The statement which provides evidence about the decreased rate of cell division is B)Decreased affinity of growth factor receptors for their respective ligands. So, correct option is B.

In each of the 4 tissues, there was a critical decline in cell division rates with age. Conversely, cell division rates didn't diminish in that frame of mind of matured mice, and just little abatements were seen in their small digestive tract or throat. These outcomes have significant ramifications for grasping the connection between ordinary undeveloped cells, maturing, and disease. Besides, they give a conceivable clarification to the baffling age-subordinate deceleration in disease frequency in exceptionally old people however not in mice.

Another assessment of recently distributed information recommended to us that the amassing of changes could slow, as opposed to increment, as people age. To make sense of this surprising finding, we estimated that ordinary undifferentiated cell division rates could diminish as we age. To test this speculation, we assessed cell division rates in the epithelium of human colonic, duodenal, esophageal, and back ethmoid sinonasal tissues.

Hence, correct option is B.

To know more about cell division, visit here:

https://brainly.com/question/29773280

#SPJ4

(Complete question) is:

Research on aging suggests that as cells age, their rate of cell division decreases until they ultimately no longer divide. Which of the following would provide evidence that the decreased rate of cell division is a cellular response related to cell signaling?

A. Decreased numbers of cytoplasmic ribosomes

B. Decreased affinity of growth factor receptors for their respective     ligands

C. Decreased hormone production in aged cells

D. Decreased ATP production in aged cells

4. Name one thing that might affect section B of the graph above.
5. Justify your reasoning for how it will affect that section.

Answers

One thing that can affect the section B in the given graph is Human greed.

What is exponential growth?

When a population's per capita growth rate remains constant, regardless of population size, exponential growth occurs, causing the population to grow exponentially as the population increases.

Many seal populations are declining as a result of human avarice. Millions of seals were slaughtered in the past for their pricey meat, fat, and fur.

Because seals are blamed by fishermen for the loss in fish stocks, seals are still murdered in huge numbers in several nations.

Thus, this can affect section B of the graph.

For more details regarding exponential growth, visit:

https://brainly.com/question/12490064

#SPJ1

rank the following cells and particles in order according to size, with the smallest at the top and largest at the bottom.

Answers

The rank of particles in order according to size, with the smallest at the top and the largest at the bottom:

1. Protein

2. T2 bacteriophage

3. Influenza virus

4. E. coli bacterium

5. Eukaryotic cell

Protein- 3-6 nm, Proteins are in charge of nearly every aspect of cellular life, including the internal organization and shape of cells, the production of products, the removal of waste, and routine maintenance.

T2 bacteriophage- 60 nm, Enterobacteria phage T2 is a virus that infects and kills E. coli. It belongs to the family Myoviridae and the genus Tequatrovirus.

Influenza virus-  60 to 160 nm, An infection of the respiratory system's nose, throat, and lungs is known as the flu (influenza).

E. coli bacterium- 2000 nm, A Gram-negative, facultatively anaerobic, rod-shaped coliform bacterium belonging to the genus Escherichia.

Eukaryotic cell- 10,000 nm, eukaryote, any cell or organism with a distinct nucleus. The eukaryotic cell has an atomic layer.

Know more about bacteriophage here: https://brainly.com/question/29409301

#SPJ4

(complete question)

rank the following cells and particles in order according to size, with the smallest at the top and the largest at the bottom.

E. coli bacterium, Eukaryotic cell, T2 bacteriophage, Protein, Influenza virus

PRETTY PLEASE ANSWER BY TONIGHT, THANK YOU! : Tall red-flowered plants are crossed with short white-flowered plants. The resulting F1 generation consists of all tall pink-flowered plants. Assuming that height is a simple case of dominance and flower color involved incomplete dominance, determine the results of an F1 cross of TtRW plants. Determine the gametes, then using a Punnett square, find the genotypes and phenotypes of the F2 generation.

Answers

Result of F1 cross:

Genotypes of F2 offspring would be 1 TTRR, 2 TTRW, 2 TtRR, 4 TtRW, 1 TTWW, 2 TtWW, 1 ttRR, 2 ttRW, and 1 ttWW

The phenotypes of F2 offspring would be tall and red-flowered, tall and white-flowered, tall and pink-flowered, short and red-flowered, short and white-flowered, and short and pink-flowered.

Dihybrid crossing

The cross is between two TtRW plants. The height (Tt) exhibits simple dominance/recessiveness while the color (RW) exhibits incomplete dominance.

TtRW gametes: TR, TW, tR, and tW

Crossing two TtRW:

        TtRW    x    TtRW

Offspring genotype and phenotype

1 TTRR: tall, red-flowered2 TTRW: tall, pink-flowered2 TtRR: tall, red-flowered4 TtRW: tall, pink-flowered1 TTWW: tall, white-flowered2 TtWW: tall, white-flowered1 ttRR: short, red-flowered2 ttRW: short, pink-flowered1 ttWW: short, white-flowered

More on dihybrid crosses can be found here: https://brainly.com/question/1185199

#SPJ1

The cortical regions indicated by E are involved in which functions?
A. The production and interpretation of language.
B. The storage of motor patterns for skilled movements of skeletal muscles.
C. The generation of emotional responses.
D. The control centers for homeostatic and endocrine functions.

Answers

The cortical areas indicated by E are involved in the functions of the production and interpretation of language.

The true choice is A.

The most important part of the brain in language activities is the cerebrum. The part of the cerebrum that is directly involved in language processing is the cerebral cortex. The cerebral cortex is the part that looks like white lumps and is the largest part of the human brain system. This section regulates or manages cognitive processes in humans, and one of them, of course, is language.

The cerebral cortex consists of two parts, namely the left hemisphere and the right hemisphere. The right hemisphere controls the processing of spatial and visual information (seeing, coloring, or perceiving spaces or objects in three dimensions). While the left hemisphere controls language activities besides, of course, other cognitive processes. Coordination between the two is possible because of the structure that identifies these two parties, namely the corpus callosum.

This question is accompanied by an image.

Learn more about the brain works in the process of language at https://brainly.com/question/12423054

#SPJ4

The basic elements of the nervous system are called Multiple Choice erythrocytes. neurotransmitters. neurons. neutrophils.

Answers

The basic elements of the nervous system are called neurons (Option C).

What are the neuron cells of the nervous system?

The neuron cells of the nervous system are the most important cells of this organ system which are responsible for receiving and sending messages to the brain and thus transducing the signals from the surrounding environment

These cells (the neuron cells of the nervous system) are also known as nerve cells due to their relative importance in this organ system and s they receive sensory signals from the surrounding conditions and also motor executive functions to the muscle cells.

Therefore, with this data, we can see that the neuron cells of the nervous system are the most important cells of the nervous system whose main function is to transmit messages from the surrounding input environment to functions that are processed into the brain.

Learn more about the neuron cells here:

https://brainly.com/question/13061744

#SPJ1

HELP IM ON LIMITED TIME

During photosynthesis, plants convert sunlight into what substance to be used for energy?

Select one:
iron sulfide
carbon dioxide
oxygen
glucose

Answers

glucose is the answer because that causes energy

Answer:

The correct answer is glucose. During photosynthesis, plants use sunlight to convert carbon dioxide and water into oxygen and glucose, which is used for energy. Glucose is a simple sugar molecule that can be used by plants and animals for energy.

jpshindell13

Explanation:

HELP! Some organisms like squirrels will give a warning call if a predator is near. Why do squirrels do this if they threaten their own existence?

Answers

Answer:

This can help the group to avoid danger and increase their chances of survival. While giving a warning call may put the individual squirrel at risk, the benefits of warning the rest of the group can outweigh this cost. Additionally, some research has suggested that animals that give warning calls are less likely to be targeted by predators, as the calls can alert the predator to the presence of the group and make it more difficult for the predator to catch any individual member of the group. Overall, giving warning calls can be an effective strategy for increasing the survival chances of the group as a whole.

What genes give cell the instructions
of what to differentiate into?
A. master control genes
B. enzyme genes
C. RNA

Answers

Answer:

This are the master control genes.

A. master control genes

In genetics, a master regulator is a gene at the top of a gene regulation hierarchy, particularly in regulatory pathways related to cell fate and differentiation.Master regulatory refers to a substance or process that regulates or controls another. In genetics, a master regulatory gene codes for a factor capable of regulating expression of another (downstream) gene.

How they work?

They produce proteins that act as transcription factors to produce proteins specific to the function of the particular cell type. They are often capable of changing some fully differentiated cells of different types into their particular cell type.

Thus, option A is correct.

Learn more:

brainly.com/question/19947953

review the relationship between genotypes and phenotypes by clicking and dragging the labels to the correct location to correctly complete each statement.

Answers

Genotype alludes to the alleles you have for a specific quality or set of qualities. phenotype is the actual quality itself, which might be affected by genotype and natural variables.

The term "phenotype" alludes to the detectable actual properties of a life form; these incorporate the organic entity's appearance, improvement, and conduct. An organic entity's not entirely set in stone by its genotype, which is the arrangement of qualities the living being conveys, as well as by natural impacts upon these qualities.

A singular's genotype is the blend of alleles that they have for a particular quality. A singular's aggregate is the mix of perceptible attributes or qualities. While a living being's genotype is straightforwardly acquired from its folks, the phenotype is just impacted by the genotype.

To learn more about genotypes and phenotypes here

https://brainly.com/question/20730322

#SPJ4

During Charles Darwin’s first presentation following his voyage on the HMS Beagle, he attempts to document his evidence of gradualism – an idea he learned about from reading Charles Lyell’s book Principles of Geology. What evidence did he present? What did he describe as the “key” to the
formation of mountains?

Answers

He found fossils in top where it should be miles below.

Charles Darwin’s describe a lot of time as the key to the

formation of mountains.

Who is Charles Darwin?

Charles  Darwin was an English naturalist, geologist, and biologist, widely known for his contributions to evolutionary biology.

Charles  Darwin proposed that all species of life have descended from a common ancestor is now generally accepted and considered a fundamental concept in science.

Charles  Darwin  first presentation following his voyage on the HMS Beagle, he attempts to document his evidence of gradualism – an idea he learned about from reading Charles Lyell’s book Principles of Geology found fossils in top where it should be miles below. So he concluded that a lot of time as the key to the formation of mountains.

Learn more about Charles  Darwin at:

https://brainly.com/question/1279802

#SPJ1

Angelman syndrome is caused by a mutation in a paternally imprinted gene on chromosome 15. Which of the following statements is true? Select all that apply. Deletion of the paternal gene copy (but normal maternal copy) could produce the syndrome Children of affected females have a 50% chance of showing the syndrome Meiotic nondisjunction of a normal paternal chromosome 15 accompanied by loss of a normal maternal chromosome 15 in a zygote could produce the syndrome Meiotic nondisjunction of a normal maternal chromosome 15 accompanied by loss of a normal paternal chromosome 15 in a zygote could produce the syndrome Children of affected males have a 50% chance of showing the syndrome Deletion of the maternal gene copy (but normal paternal copy) could produce the syndrome

Answers

The following statements are true for the production of Angelman syndrome:

2. Children of affected females have a 50% chance.

3. Meiotic nondisjunction of a normal paternal chromosome 15 accompanied by loss of a normal maternal chromosome 15

6. Deletion of the maternal gene copy

The mutated or missing maternal copy of a portion of chromosome 15 causes Angelman syndrome. Most of the time, it is because of the gene UBE3A, which is on chromosome 15 at the 15q11 to 15q13 locus. It encodes the ubiquitin protein, which is necessary for the electron transport chain and various functions of the cell membrane.

In most cases, this father-inherited gene is deactivated in the cortex, thalamus, and hippocampus of the brain. In these regions, the only source of genetic information for ubiquitin synthesis is the maternal gene. Therefore, neurological symptoms result from any mutation or deletion of this gene or a portion of chromosome 15 in the maternal gamete. The offspring are unaffected by mutations in the paternal gamete.

know more about Angelman syndrome here: https://brainly.com/question/10485304

#SPJ4

If you did an experimental cross and it got 1152 individual offspring how many of those offspring would have to be yellow to have a 3 to 1 yellow to green ratio from the cross

Answers

Answer: 864 yellow 288 green

Explanation:

From the list below, select ALL of the structures that are part of the sexual life cycle of Basidiomycota. [Do not select any structures that are part of asexual reproduction.) Conidia Ascospore Basidiospore Zygospore Rhizopus sporangium Conidiospore Ascus Basidium

Answers

Basidiospore, Basidium, Ascus are the structures that are part of the sexual life cycle of Basidiomycota.

Basidiomycota are a group of fungi that reproduce sexually through a process called basidiomycetous reproduction. In this process, the fungi produce special reproductive structures called basidia, which are located on the surface of the fruiting body (also known as the basidiocarp). The basidia contain special cells called basidiospores, which are released when the basidia mature and burst. The basidiospores are then carried away by wind or other means and can germinate to form new fungal cells. The process of basidiomycetous reproduction also involves the formation of asci, which are special cells that contain ascospores. These ascospores are produced through meiosis and can give rise to new fungal cells when they germinate. The structures listed above that are NOT part of the sexual life cycle of Basidiomycota include conidia, conidiospores, zygospores, and rhizopus sporangium, which are all involved in asexual reproduction.

To know more about ascospore

https://brainly.com/question/15047851

#SPJ4

SOMEONEEEEEE PLEASE HELP ILL GIVE 20 POINTSZ!​

Answers

Answer:

YOU SAID 20 POINTS AN DYOU GIVEN ME 5 HUN NO THANK YOU BYE

Explanation:

ANSWER;20

What happens if the mass of the elements is greater compared to smaller ?

Answers

Hello. More information is needed to answer your question accurately. However, I will try to help you in the best possible way

If you are referring to what happens if the mass of an atom is greater compared to an atomic number, we can say that there is nothing too much, since it is normal for the atoms to have a mass slightly greater than the atomic number. The mass of an atom can never be less than the number of protons added to the number of neutrons. An atom with greater mass has a greater number of electrons and neutrons in relation to an atom of less mass and it is likely that the atom of less mass will donate or share electron with the atom of greater mass so that both reach the electric balance.

Other Questions
A jazz band wants to sell $2,800 worth of tickets. If each ticket costs $70, how many tickets will the band have to sell to meet its goal? carolhas created a subnet of 10.20.30.0/27. which of the following is the address that is used for broadcast messages within the subnet? Convert 400 liters per day to gallons per week show work 11 12 13 14 15 16 17 18 19 20 Given: AB = BC Prove: B is the midpoint of AC. A line contains point A, B, C. A flow chart has 3 boxes that go from top to bottom. The first box is labeled given and contains A B = B C. The second box is labeled definition of congruent segments and contains Line segment A B is-congruent-to Line segment B C. The third box is labeled definition of a midpoint and contains B is the midpoint of Line segment A C. What is the format of this proof? two-column proof one-paragraph proof flowchart proof two-paragraph proof Mark this and return The dotted arrow in this reaction is a placeholder. Select the arrow that best describes the relationship between the reactants and products. -CECAH -CEC-L Identify the correct arrow descriptor. What do you mean by political party? Lysosomes are organelles that contain enzymes. What is the function of a lysosome? What was Samuel Johnson's most important work? What mixed number is equal to 11/6? Is running an example of homeostasis? Abag contains n beads. 6 of the beads are red and the rest are blue. Ravi is going to take at random 2 bead How does the image above reflect the influence of medieval art on renaissance painters? Does Laertes get his revenge? Because of the adductor brevis, adductor longus, and adductor magnus insertions on the linea aspera, the concentric contractions of these hip adductors tend to cause hip _____. How the play develops a theme related to the topic of revenge? What are direct primary elections? How many terms are there in 4xy 5? A student wanted to find out how temperature might affect the germination of seeds.(1) What is the variable that should be changed?(2) What is the variable that should be measured?(3) What are the 3 important variables that should be kept constant? What is a campaign and why is it important? Who mapped the ocean floor using sonar?