A prevailing wind coming from the North Pole would each type of prevailing wind have on the land it crosses.
What are the three different kinds of prevailing winds?
The trade winds, prevailing westerlies, and polar easterlies are the three predominant wind belts connected with these cells.
Although prevailing winds frequently come from the north sea and provide moisture to the land, they can also bring moisture to the land. There is no moisture or water involved when wind comes from a land location. This means that the winds bring more dry air into the atmosphere, reducing the likelihood of rain.
For more information regarding prevailing winds, visit:
https://brainly.com/question/27103454
#SPJ1
The sugar and phosphate portion of the nucleotides are found _____ on the DNA twisted ladder.
The sugar and phosphate portion of the nucleotides are found "as segments of the rails" on the DNA twisted ladder.
Wild salmon spend most of their lives in the ocean but return to freshwater rivers to spawn, or reproduce. Most wild salmon will only spawn in specific spawning grounds in the rivers in which they were born. The construction of hydroelectric dams in rivers has blocked the paths of some salmon returning to their spawning grounds. This has led to population declines. Which method would be most effective in preventing further wild salmon population declines caused by the construction of hydroelectric dams?
A.
establishing protected regions around wild salmon spawning grounds in specific rivers
B.
observing the migration patterns of wild salmon by tagging and tracking a small sample of fish
C.
monitoring genetic diversity by using netting to catch salmon and obtain genetic samples
D.
constructing passageways next to dams to allow salmon to swim around blocked rivers
Constructing passageways near the dams to allow to salmon to swim around blocked rivers. Thus, option "D" is correct.
How, explain your answer briefly?The construction of dams in rivers has blocked the path of some salmons returning to spawning grounds.
The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.
Thus, option "D" is correct.
To learn more about salmons click here:
https://brainly.com/question/16208604
#SPJ1
What are the organneles that distinguish plant cell from animal cell.
Plant cells have plastids and larger vacoule and they also have tough cellulosic cell wall outer to cell membrane as a covering.
Animal cells don't have cell wall rather they have cell membrane as it's outermost covering and they have smaller vacuoles.They also don't have plastids.They have centrosome which is not found in plant cells.
what would most likely happen if a person increased the amount of saturated fat in his or hers diet?
If a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well.
What is the harmful effect of saturated fatty acids?Because saturated fatty acids are completely saturated with hydrogen, they require more energy to break down and generally remain in the solid at room temperature, as well as inside the body, where they can induce heart-related diseases and obesity by blocking blood vessels. For example, butter contains saturated fatty acids, which are generally not recommended in large quantities.
Hence, if a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well..
Learn more about the harmful effects of saturated fatty acids here.
https://brainly.com/question/14118324
#SPJ2
The group of polar bears that live along the eastern coast of Russia makes up
an organism.
a community.
an ecosystem.
a population.
The cluster of polar bears that live along the eastern coast of Russia build a population. The correct option is D.
What is a population?The group of organisms living in a particular area forms the population of that given area.
As given, a cluster of polar bears that live along the eastern coast of Russia build a population.
Thus, the correct option is D.
For more details regarding population, visit:
https://brainly.com/question/16138725
#SPJ1
Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factors in their work that could increase their chances of cancer?
This is the complete question.
Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factor
in their work that could increase their chances of cancer?
A. Scientists who work with toxic chemicals
B.therapist who operate radiation machine
C.nurses who treat patients with viral infections
D.researches who study DNA replication
Research that study DNA replication. Thus, option "D" is correct.
What is cancer?Cancer directs to any one of a considerable number of diseases described by the growth of anomalous cells that separate uncontrollably and have the ability to enter and destroy ordinary body tissue.
Cancer often has the ability to spread throughout your body. Cancer is the second-main cause of dying in the world.
Thus, option "D" is correct.
To learn more about Cancer click here:
https://brainly.com/question/8590464
#SPJ1
What process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates?
Answer:
Precipitation
Explanation:
Precipitation refers to a process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates.
Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.
Answer:
B.) Can lead to new species that share common ancestors
Explanation:
Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).
Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation
I'll give brainly to whoever response is good !
please help me :C
Answer:
At the beginning of the follicular phase, the lining of the uterus (endometrium) is thick with fluids and nutrients designed to nourish an embryo. If no egg has been fertilized, estrogen and progesterone levels are low. As a result, the top layers of the endometrium are shed, and menstrual bleeding occurs.
What factors can limit growth?
competition
amount of sunlight or water
r-selected species
geographic borders
The answer is
Amount of sunlight or water.
As growth depends on sunlight and water so it is important to grow a plant in proper sunlight and giving plants regular water is also important.
learn more things about what factors growth
https://brainly.com/question/3944507
Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA
In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
What are restriction enzymes?Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).
These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.
In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
Learn more about restriction enzymes here:
https://brainly.com/question/15278286
#SPJ1
making nectar costs a plant energy because it uses up glucose that the plant has made. explain why the expense is worthwhile
Answer:
Nectar in flowers serves chiefly to attract pollinators, such as fruit-eating bats, hummingbirds, sunbirds, and insects. Nectaries are usually located at the base of the flower stamens, which draw animal visitors into contact with the pollen to be transferred.
Explanation:
Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?
The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.
What is Taxonomic classification system?This is defined as the classification of organisms based on shared characteristics.
This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.
The complete question is:
Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.
Which of the following best explains why a standardized classification system is important to the scientific community?
Read more about Taxonomic classification system here https://brainly.com/question/11724129
#SPJ1
Which feature of the ocean floor includes its deepest parts?
4. Which statement best describes how scientists formed cell theory?
A:Pasteur observed that cork was made of cells and published his findings
widely,
B:Multiple scientists and observations contributed to the formation of cell
theory.
C:Schwann observed that plants are made of cells and shared his theory at
conferences.
D:Remak wrote cell theory after realizing that cells cannot come from non-
living matter.
Answer:
A is the answer
Explanation:
please mark me as brainlist
Who establishes a crime scene?
options:
crime scene photographer
criminal investigator
first responder
district attorney
Answer:
first responders
Explanation:
no need for explaining
10 points!
A fungal ____________ is a haploid reproductive cell that is capable of developing into a new organism.
Answer:
it’s a spore
Explanation:
it should be a spore. It’s because the spore is the haploid.
The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic. Which is which
Which of the following is a natural resource for humans?
A-Cars
B-Electricity
C-Houses
D-Wood
An organism that is eaten by a predator is
Prey is a term given to the organism that is eaten by the predators.
One possible reason for the rise in the average air temperature at the Earth's surface is that
Answer:
cimate change
For a long time, penicillin was given to people to kill the bacteria which caused ear infections. Lately, some ear infections are not cured by penicillin. Which is the best explanation for this?
Answer:
Some bacteria have mutated and are not killed by the penicillin
Explanation:
Which environment would you mostly find animals wuth chemosynthetic bacteria embedded in their tissue
hypothermal vent community.Chemosynthetic symbioses predominate in most deep-sea ecosystems, but they can also infrequently be found at near the surface vents and seeps.
Where would you anticipate to find a most aquatic life?The euphotic zone, which can be found up to 200 metres (656 feet) beneath the surface, is the uppermost portion of a marine ecosystem.Light levels are enough for routine photosynthetic activity at this depth.This area is home to most aquatic life.
Which habitat has water that is subject to tide changes?An ecosystem known as the intertidal zone can be found on sea shorelines, where a wide variety of creatures can tolerate changes in tide levels.
To know more about ecosystems visit:
https://brainly.com/question/13979184
#SPJ1
A model train running on an inclined track is part of a closed system that has
316 J of mechanical energy. If the kinetic energy of the train decreases from
314 J to 250 J, what happens to the gravitational potential energy of the system?
A. It decreases from 316 J to 314 J.
B. It increases from 2 J to 66 J.
C. It decreases from 66 J to 2 J.
D. It increases from 316 J to 564 J.
Taking into account the definition of kinetic, potencial and mechanical energy, the correct answer is option B: the gravitational potential energy of the system increases from 2 J to 66 J.
Kinetic energyKinetic energy is a form of energy. It is defined as the energy associated with bodies that are in motion and this energy depends on the mass and speed of the body.
Kinetic energy is defined as the amount of work necessary to accelerate a body of a given mass and at rest, until it reaches a given speed. Once this point is reached, the amount of accumulated kinetic energy will remain the same unless there is a change in speed or the body returns to its state of rest by applying a force.
Potential energyOn the other hand, potential energy is the energy that measures the ability of a system to perform work based on its position. In other words, this is the energy that a body has at a certain height above the ground.
Gravitational potential energy is the energy associated with the gravitational force. This will depend on the relative height of an object to some reference point, the mass, and the force of gravity.
Mechanical energyFinally, mechanical energy is that which a body or a system obtains as a result of the speed of its movement or its specific position, and which is capable of producing mechanical work. Then:
Potential energy + kinetic energy = total mechanical energy
The principle of conservation of mechanical energy indicates that the mechanical energy of a body remains constant when all the forces acting on it are conservative (a force is conservative when the work it does on a body depends only on the initial and final points and not the path taken to get from one to the other.)
Therefore, if the potential energy decreases, the kinetic energy will increase. In the same way, if the kinetics decreases, the potential energy will increase.
Gravitational potential energy of the system in this caseThe principle of conservation of mechanical energy can be applied in this case.
A model train running on an inclined track is part of a closed system that has 316 J of mechanical energy.
The kinetic energy of the train is 314 J at the beginning.
Replacing in the definition of mechanical energy:
Potential energy + 314 J = 316 J
and solving you get:
Potential energy = 316 J - 314 J
Potential energy= 2 J
Then, the potential energy of the train is 2 J at the beginning.
The kinetic energy of the train is 250 J at the end.
Replacing in the definition of mechanical energy:
Potential energy + 250 J = 316 J
and solving you get:
Potential energy = 316 J - 250 J
Potential energy= 66 J
Then, the potential energy of the train is 66 J at the end.
Finally, the correct answer is option B: the gravitational potential energy of the system increases from 2 J to 66 J.
Learn more about mechanical energy:
brainly.com/question/17809741
brainly.com/question/14567080
brainly.com/question/12784057
brainly.com/question/10188030
brainly.com/question/11962904
#SPJ1
PLEASE HELP PLEASE
Do you think this is a good way to eliminate invasive species from an ecosystem? Do you think the risks of the gene drive getting into another species are worth gaining biodiversity in an ecosystem? Explain your opinion.
Use of bioagent is a good way to eliminate invasive species from an ecosystem.
What is a good way to eliminate invasive species from an ecosystem?In my opinion, to eliminate the invasive species from an ecosystem we should find out its bioagent instead of chemical spraying because bioagent does not adversely affected the environment.
The risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem because it leads to many consequences and unpredictable effects on ecosystem.
So we can conclude that use of bioagent is a good way to eliminate invasive species from an ecosystem.
Learn more about invasive here: https://brainly.com/question/1542287
#SPJ1
Yes, it is a good way to eliminate invasive species from an ecosystem. This is because invasive species play a critical role in the limitation of biodiversity of a particular ecosystem.
What is Biodiversity?Biodiversity may be defined as the sum total of all the variety of living organisms in a particular ecosystem.
No, the risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem. This is because it directs considerable influences and unanticipated impacts on the ecosystem.
Therefore, it is well described above.
To learn more about the Ecosystem, refer to the link:
https://brainly.com/question/26551655
#SPJ1
Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent
the correct answer is detergent which is not approved
The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.
What is a hand sanitizer?Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.
Detergents are not approved during the formation of hand sanitizer.
Thus, the correct option for the given scenario is D.
For more details regarding sanitization, visit:
https://brainly.com/question/4296165
#SPJ2
3. Meiosis is a process that occurs during cell division that leads to the production of gametes It halves the number of chromosomes that can be passed on to an offspring. It also produces new combinations (variations) of an organism's genetic material Use evidence you obtained from modeling meiosis to show that both statements are true
Answer:
reproduction
Explanation:
different traits
Economic importance of tilapia fish
Answer:
Tilapia is one of the most productive and internationally traded food fish in the world. The production of farmed tilapia is among the fastest expanding food sectors in the world. Nile tilapia ( Oreochromis niloticus) is the most cultured freshwater species among the farmed tilapia and contributes about 71% of the world total tilapia production.
Tilapia is one of the most important farmed fish species worldwide (FAO 2018) and an important source of protein (Fitzsimmons 2000;Hai 2015). Due to its sequenced genome (Conte et al. 2017), easy reproduction, efficiency in adapting to diverse diets, high resistance to diseases and handling practices, and high tolerance of a wide variety of husbandry conditions, it is considered an ideal model in toxicological research.
Explanation:
I hope it helps
Which ,begin emphasis,two,end emphasis, statements describe how constantly changing conditions affect the overall population size of organisms living in the area?
The correct options would be B and E.
Variation in population sizeThe population size of each organism in different zones may not vary much due to the following:
Organisms in each zone have characteristics that make them be well-adapted to the zone. These include structures that help them attach to the rock, structures that help them breathe when exposed to the air, and so on.More on adaptations of organisms can be found here: https://brainly.com/question/1686177
#SPJ1
We can mold metals into different shapes because they are _____________.
ductile
malleable
lustrous
Answer:
We can mold metals into different shapes because they are _malleable__.
Explanation:
Malleable (ability to be hammered into thin sheets)