What is comparative advantage and why does it lead to mutually beneficial exchange?

Answers

Answer 1

The ability of an economy to produce a specific good or service at a lower opportunity cost than its trading counterparts is known as comparative advantage. Comparative advantage is a theory that explains why businesses, nations, or people might gain from trade.

What is trade?

Trade is the act of transferring commodities or services between individuals, businesses, or nations. The discussions for a new international trade agreement were directly under the ministry's jurisdiction in every facet of foreign commerce.

Trade that is mutually beneficial and advantageous. Both countries can profit when they trade with one another and grow output in their areas of comparative advantage. A helpful tool for visualizing this advantage is the production possibilities frontier.

Therefore, The notion of comparative advantage explains why trade may benefit people, countries, or businesses.

Learn more about trade here:

https://brainly.com/question/27622280

#SPJ4


Related Questions

which of the following is a key concept in wachtel's cyclical psychodynamic-behavior therapy? question 29 options: clients' behaviors demonstrate a cycle of acting on demands from their id and superego until they can find a balance. clients are seeking personal growth and must have basic needs met before they can fulfill self-actualization. people will repeat negative patterns of behavior until they are able to gain insight into the causes and consequences of those behaviors. the relationship between the therapist and client shows a cycle of positive and negative interactions during treatment, and those must be addressed as they occur.

Answers

The key concept in Wachtel's cyclical psychodynamic-behavior therapy is  client shows a cycle of positive and negative interactions during treatment, and those must be addressed as they occur. Option (d) is correct.

What do you mean by Therapy?

Therapy is a form of medicine that, particularly following disease, aids in recovering from, strengthening, etc.

The client-psychotherapist interaction is crucial to therapy and may even influence how things turn out. It can be challenging to strike the right balance between paying too much attention to the therapeutic connection and not paying enough. Relationships the client maintains outside of therapy can be crucial in the maintenance or modification of the client's problematic behavioral patterns, proving that the therapist-client relationship is not the only one that has an impact on the client.

Therefore, Option (d) is correct. The key concept in Wachtel's cyclical psychodynamic-behavior therapy is  client shows a cycle of positive and negative interactions during treatment, and those must be addressed as they occur.

Learn more about Therapy, here;

https://brainly.com/question/29854280

#SPJ1

Steps in the Assessment Process

Answers

The nurse observes that the client's belly is obviously swollen and decides to continue with the abdominal assessment by doing auscultation.

The nurse should start with review before moving on to hearing while doing an abdominal evaluation because playing scrutiny or percussion before hearing could disrupt normal activity and throw off the assessment. Auscultation is the process of listening to the body's internal noises while usually using a medical device. Hearing is done in order to examine the circulatory and metabolic processes, as well as the alimentary canal. René Laennec was the one who coined the phrase. In the first three lessons, classroom assessment design is introduced, with a focus on fundamental ideas including the five components of assessment design, validity, reliability, goals of assessment, and assessment items.

Learn more about Assessment here :

https://brainly.com/question/29423619

#SPJ4

In what Supreme Court case did the Court rule the school may restrict student speech in a school newspaper?

Answers

In Brandenburg v. Ohio, 395 U.S. 444 (1969), the Supreme Court case did the Court rule the school may restrict student speech in a school newspaper.

What has the US Supreme Court said regarding the right to free speech?

In Brandenburg v. Ohio, 395 U.S. 444 (1969), the Supreme Court determined that speech endorsing criminal action is protected by the First Amendment unless it is likely to spark impending lawlessness.

What rights to free expression in schools has the Supreme Court upheld?

The U.S. Supreme Court publicly acknowledged that kids do not "lose their constitutional rights to freedom of speech or expression at the schoolhouse gate" in the seminal Tinker v. Des Moines Independent Community School District case.

For additional information on student speeches, go to: speeches, go to:

brainly.com/question/23744014

#SPJ4

Which is a push factor of migration?

Answers

People are "pushed" away from their homes by push causes, which can include conflict. People are drawn to new places by "pull" reasons like improved opportunities. Most frequently, economic, political, cultural, or environmental factors drive migration.

What is conflict?

Conflicts result from conflicts of interest, viewpoints, or even philosophical concepts. The basis of conflict can be personal, racial, class, caste, political, or even international, thus it will always exist in society. Conflict is a heated argument and disagreement about a significant issue. When two parties or groups are at odds,

Low productivity, unemployment, underdevelopment, unfavorable economic circumstances, a lack of opportunity for progress, the depletion of natural resources, and natural disasters are common push factors. Push factors, such as poverty, a lack of social mobility, violence, or persecution, are causes people to leave their homes.

Therefore, Push causes, which can include conflict, "push" people out of their homes.

Learn more about the conflict here:

https://brainly.com/question/17085630

#SPJ4

Bandura's famous bobo doll experiment is most closely associated with?

Answers

Albert Bandura is an influential social cognitive psychologist, perhaps best known for his social learning theory, the concept of self-efficacy, and the famous Bobo Doll experiment.

Conclusion. The Bobo doll experiment showed that children can learn social behaviors such as aggression through the process of observational learning by observing the behavior of others. This result supports the social learning theory of Bandura (1977). In Bandura's Bobo-Doll study, it was hypothesized that children who observe aggressive behavior in adults are more likely to repeat that aggressive behavior in the absence of adults. Infants have been shown to imitate model aggressive behavior even in the absence of conclusive evidence. The results of the Bobo-Doll experiment showed that children exposed to aggressive models were more likely to exhibit imitative aggressive behavior, as expected from prediction

To know more about social learning theory visit:

https://brainly.com/question/26256217?referrer=searchResults

#SPJ4

What is the significance of the opening scene in The Scarlet Letter?

Answers

Opening scene in Scarlet letter introduces the viewer to a symbol that keeps showing up. Here, Dimmesdale is pleading with Hester to expose him in front of the gathered audience as her fellow sinner.

Similar to the A Hester wore on her chest, a meteor formed an A as it travelled across the sky. Dimmesdale and Hester were to meet in the woodland to discuss their intentions to go to England as a family. A few hours later, Dimmesdale made an electoral address, but he was planning to depart town. With Hester and Pearl by his side, Dimmesdale confessed to the community from the scaffold because he knows what is right. He showed a scarlet letter that had been burned into his skin on his chest before he passed out. Hester and Pearl go, but they eventually come back. When they go back, they learn that Chillingworth had also passed away. Chillingworth had left Pearl with all of his belongings.

Learn more about Scarlet letter here:

https://brainly.com/question/29553419

#SPJ4

How long can you stay on SSDI?

Answers

SSDI establishments are taxpayer supported initiatives that give monetary help to individuals who have a physical or mental incapacity of some sort or another.

The population's tax declarations are linked to this financial assistance.Consequently, SSI and SSDI payments are also delayed when tax declarations are delayed. In any case, the public authority specifies that the installment of these guides will be made until the seventh of April.Benefits from Social Security Disability Insurance (SSDI) may be subject to taxation.

The federal insurance program known as Social Security Disability Insurance (SSD or SSDI) is financed by payroll taxes and is run by the United States government. It is administered by the Social Security Administration and is intended to provide monthly benefits to individuals with a physical or mental disability that is medically determinable and prevents them from working. SSDI does not pay benefits that are only partial or temporary; rather, it only pays benefits when the disability is "expected to last at least one year or result in death."

Learn about SSDI:

https://brainly.com/question/25246226

#SPJ4

What are the possible sources of the information that defines the functional dependencies that hold among the attributes of a relation schema?.

Answers

A functional dependency describes the relationship between the attributes of an entity such that the value of one attribute depends on and is greatly influenced by the value of another attribute.

A functional dependency exists between two attributes when the attribute of one uniquely determines the attribute of the other.

There can be various sources of information that define functional dependencies. For example, the attribute age can use the attribute ID to define a functional dependency. If you are under the age of 18, you may not include your voter ID.

Similarly, experience in a particular organization can be calculated by subtracting the hire date from the current date, so the hire date attribute can define a functional dependency using the experience attribute.

To learn more about functional dependency, here:

https://brainly.com/question/28178296

#SPJ4

Why did abolitionists want to end slavery?

Answers

The abolitionists wanted to end the ownership of slaves because they believed that slavery was an evil and a plague on the U.s.a.

The abolitionists circulated a good amount of anti-slavery literature among Southerners and petitioned Congress, sought for office, and distributed it widely. In a nation that prized individual liberty and the idea that "all men are created equal," the American Abolitionist movement sought to end slavery. As abolitionists' demands grew louder, slave owners dug back, escalating local tensions that ultimately sparked the  Civil War.

Learn more on anti-slavery

https://brainly.com/question/29506044

#SPJ4

Write a poem to express your feelings as a member of this community.

Answers

We are equal, but with diverse ways and meaning of life,

We are equal, but end with same manner in this life,

At least, we all shall wind up, not knowing the end,

At least our fate make us equal to each other, in this life,

We stumble upon the unknown end,

As if it's a new place or planet,

That we would be going to discover,

As we go, we can't come back,

Our community is large,

But with less friends,

As we consider others as strangers,

Even though they are our same kind,

They came to this world just like us,

And will come to an end just like us,

Our flowers grow, and rot till time,

Just as us, everything carry same fate,

In our world, everyone is equal,

But we are confined to communities,

Communities are built on a new dream,

That will come to others hands as well

What is an example of the 8th Amendment being used?

Answers

Eighth Amendment Cases, Unsafe and unhygienic prison facilities, excessive bail or penalties, and cruel or abusive treatment are all examples of excessive punishment.

In what ways is the 8th Amendment applied today?The Eighth Amendment's cruel and unusual provision has been used to challenge prison conditions such as extremely filthy cells, overcrowding, inadequate medical care, and purposeful failure by officials to protect inmates, among others. The cruel and unusual provision is not just applicable to criminal sentences themselves.The Eighth Amendment's cruel and unusual provision has been used to challenge prison conditions such as extremely filthy cells, overcrowding, inadequate medical care, and purposeful failure by officials to protect inmates, among others.The cruel and unusual provision is not just applicable to criminal sentences themselves.

To learn more about Eighth Amendment's refer to:

https://brainly.com/question/16944368

#SPJ4

Who are the two people conversation in the poem Mending Wall?

Answers

Rain and The poet are the two participants. The rain tells its own tale thanks to the poet. The narration is more intriguing and authentic because to this straightforward approach.

‘Mending Wall’ by Robert Frost explores what?

Robert Frost, who was born on March 26, 1874, in San Francisco, developed a love for poetry while he was a student at Lawrence High School. On November 8, 1894, The Independent published his first poem, My Butterfly, which was his first poem to be published. Elinor Miriam White, Frost's wife who passed away in 1938, was a major inspiration for his poetry, including "Mending Wall." Frost was significantly influenced by contemporary British poets.

About "Mending Wall"

Mending Wall was released in 1914 by David Nutt, and you may read it in its entirety here. It is regarded as one of the poems that has been studied and collected the most in contemporary literature.The poet, a New England farmer, is seen in the poem walking alongside his neighbor to mend the stone wall that divides their two fields in the spring. The narrator asks his neighbor why a wall is necessary as they begin to repair the wall. Although his neighbor asserts that "excellent fences make good neighbors," the poet asserts that there is something that doesn't love a wall.This poem also highlights the significance of international borders and walls. It also helps to respect your neighbor's privacy in our lives when a wall serves as a barrier for persons like the seemingly socially awkward. We do, after all, inhabit a civilized society. Keeping your distance is always preferable, and effective fences help you do just that.

To learn more about Mending Wall refers to :

https://brainly.com/question/29887971

#SPJ4

9. Select the options that best describe a LIMITED GOVERNMENT.
(SELECT ONLY 4. You will not earn any points if you select more than 4.)
(Civics NAEP: ID. Governments)

Answers

Answer:

Here are four options that best describe a limited government:

1. A limited government is one in which the powers of the state are restricted and defined by a constitution or other legal document. This means that the government can only exercise those powers that have been specifically granted to it, and it cannot overstep its authority or encroach on the rights and freedoms of citizens.

2. A limited government is characterized by the separation of powers, which means that the different branches of government (executive, legislative, and judicial) are designed to check and balance one another. This helps to prevent any one branch from becoming too powerful and helps to ensure that government actions are accountable and transparent.

3. A limited government is often associated with democratic systems of government, where the people have a say in the decision-making process and can hold their elected representatives accountable through the ballot box. This ensures that the government is responsive to the needs and concerns of the citizens.

4. A limited government is one that respects and protects individual rights, including the right to free speech, the right to privacy, and the right to be free from unreasonable searches and seizures. This helps to ensure that the government does not abuse its power and that citizens are able to live their lives freely and without interference.

What was the result of the Schenck decision it made striking against war industries illegal?

Answers

It made it illegal to strike against war industries. It expressed that First Correction privileges don't make a difference in wartime.

How did the Schenck decision affect things?

United States, 249 U.S. 47 (1919) The speaker is not protected by the First Amendment from government action if speech is intended to result in a crime and there is a clear and present danger that it will.

How did the Schenck decision affect Americans?

In Schenck v. United States (1919), the Supreme Court decided that the First Amendment does not protect speech that poses a "clear and present danger." This decision exemplifies the ways in which the Supreme Court's interpretation of the First Amendment sometimes necessitates sacrificing individual liberties to maintain social order.

To learn more about First Amendment here:

brainly.com/question/1078243

#SPJ4

what differentiates sport psychologists from exercise psychologists?

Answers

A sport psychologist will utilize exercise to improve performance levels within a specific sport, in contrast to an exercise psychologist

who employs programs that have therapeutic advantages that aid to improve the general health of those they work with.

Another common objective for exercise psychologists is the investigation of the beneficial effects of exercise on particular demographic groups.

Basically, both fields of psychology explore how to encourage people to follow suggested exercise programs in order to improve their physical and mental health.

Exercise psychologists, as opposed to sport psychologists, tend to work mostly with non-professional athletes. In spite of this, they continue to actively contribute by offering suggestions for ways to enhance the health and wellbeing of their charges.

Learn more about " psychologists " to visit here;

https://brainly.com/question/3833605

#SPJ4

What are the members of each House called?

Answers

The members of each House are called either congressman or congresswoman.

The members of the House can be referred to or considered as a group of individuals who represent their individual congressional districts from the state that they belong to. Moreover, there are certain functions and duties that are to be performed by the members of the House alongside the powers that have been vested in their hands. The members of the Houses are collectively known as congressmen or congresswomen, depending on their genders.

Learn more about the House members here:

https://brainly.com/question/10047462

#SPJ4

What was the cause of the war in Afghanistan when it began in 2001?

Answers

The cause of the war in Afghanistan in 2001 was the September 11th terrorist attacks on the United States.

The War in Afghanistan: Responding to the 9/11 Attacks

The cause of the war in Afghanistan in 2001 was justified due to the fact that the US and its allies were responding to the horrific terrorist attacks on the United States of America. The September 11th attacks on the World Trade Center and the Pentagon killed nearly 3,000 innocent people and injured thousands more.

Al Qaeda, the terrorist network responsible for the attacks, was based in Afghanistan and had the support of the Taliban. In order to prevent further attacks, the US and its allies had to remove the Taliban from power and dismantle the Al Qaeda network. This was the only way to ensure the safety and security of the United States and its citizens.

Learn more about terrorist attacks at: https://brainly.com/question/4770070

#SPJ4

What was the main goal of utopian socialism?

Answers

According to idealized notions of a perfect social order, the phrase "Utopian socialism" refers to a range of ethically grounded theories and actual movements that seek to end oppression, exploitation, and alienation.

The first movement of modern socialism and socialist thinking, as illustrated by the works of Henri de Saint-Simon, Charles Fourier, Étienne Cabet, and Robert Owen, is commonly referred to as utopian socialism. Utopian socialism is sometimes defined as the presenting of visions and plans for ideal societies that are seen or imagined in the future, with positive values serving as the primary driver of such a direction for society. Later socialists and opponents of utopian socialism believed that it was not based on the real material circumstances of today's society.

Learn more about utopian socialism here:

https://brainly.com/question/30090606

#SPJ4

In which order must classified information be marked?

Answers

The highest classification of the material on each internal page of a classified document (except from blank pages) must be prominently marked at the top and bottom of the page.

A classified document must include top and bottom markings that reflect the highest classification of the document as a whole or the highest classification of the page's content, including the word "UNCLASSIFIED" where appropriate. (3) Marking of portions. The overall categorization should be prominently shown at the top and bottom of the page. Put the overall marking at the top and bottom of the outside of the front cover, on the title page, on the first page, and on the outside of the rear cover if the document has more than one page (if any).

To learn more about document click the link below:

brainly.com/question/27396650

#SPJ4

What are 10 examples of culture?

Answers

Cultural aspects include, among other things, norms, laws, attire, architectural design, social organization, religion, language, governance, economy, and the arts.

What is the most important aspect of culture?

Language is one of the most important components of any civilization. It is the way people engage with one another, develop relationships with one another, and promote a sense of community. There are currently roughly 6,500 spoken languages in the globe, and each is unique in a variety of ways. The meaning of life and death, key life phases, relationships, status and authority, accomplishment, and group affiliation are all represented by symbols that have cultural origins. Culture conveys a variety of opinions about how society should function and how the world should be structured.

To know more about culture visit:

brainly.com/question/12718739

#SPJ4

What techniques does Robert Frost use in the road not taken?

Answers

The words "first" and "for" both contain the letter "f" twice. There have been two uses of the term "way," I'm sorry to say. Imagery: The poet beautifully captures the two morning roads.

What literary technique is used in the poem The Road Not Taken?

Approaches in this piece of writing include tone, imagery, and symbolism. The strongest literary device in this poem is symbolism, which is used in multiple lines to depict various aspects of contemporary life or the situation of the world.

What techniques are used in The Road Not Taken?

Metaphor is likely the most overt example of figurative language use in this poetry. The entire poem can be compared to the metaphor.

To know more about metaphor :

https://brainly.com/question/27250460

#SPJ4

What were the Southern responses to Reconstruction?

Answers

Until new governments could be constituted, the Reconstruction Acts imposed military administration over the Southern states.

What did the Reconstruction Act entail?

To fully appreciate the significance of the Reconstruction Acts of 1867, it is necessary to first comprehend the historical context in which they were enacted. These laws were enacted and implemented during Reconstruction, which lasted from 1865 to 1877 following the American Civil War.

Although the goal of Reconstruction was to bring the country back together, the lives lost, monies spent, towns devastated, and economic damage caused by the war left enduring resentments between the North and South. During the war, many Southern cities, including Charleston, South Carolina, sustained extensive damage.

Learn more about the Reconstruction Act with the help of the given link:

brainly.com/question/3617477

#SPJ4

a language arts test that uses examples of bus and subway schedules to measure reading comprehension is likely to favor members of which group?

Answers

A language arts test that uses examples of bus and subway schedules to measure reading comprehension is likely to favor students of urban communities.

An urban community is a place where a lot of people live and where a lot of various kinds of buildings are grouped together. An place where people live near to a city or town is called a suburb. New York City is the biggest city in the nation.

The Greater New York City region is home to more than 19 million people. Parts of Connecticut, New Jersey, and New York are included in the urban area. Urban areas are the territory around a city. While country living is easy going and peaceful, metropolitan life is fast-paced and difficult.

The urban settlement includes towns and cities. The rural settlement, on the other hand, consists of hamlets and villages. Due to the presence of the built environment, metropolitan areas are more cut off from nature.

Read more about Urban Communities:

https://brainly.com/question/27675876

#SPJ4

What do you mean by judicial review of the Supreme Court class 8?

Answers

Judicial review is the capacity of a court to decide whether a decision or law by the government is constitutional. This power was entrenched in the United States in the Supreme Court case Marbury vs Madison.

What is an example of judicial review?

An example of judicial review by the Supreme Court is annulling a president's executive command about immigration because the order breaches the Constitution.

Another example is when the Congress were to proceed a law banning newspapers from printing information about particular political matters, the courts would likely have the power to rule that this law violates the First Amendment, and for that reason, it is unconstitutional.

Learn more about judicial review at: https://brainly.com/question/28179489

#SPJ4

Providers and DMEPOS dealers obtain annual lists of valid HCPCS level II codes, which include ____ for services.
billing instructions

Answers

Annual lists of acceptable HCPCS level II codes, including billing instructions for services, are provided to providers and DMEPOS dealers.

Social services are a type of governmental service that provides support and aid to specific groups, most notably the poor. Individuals, corporate and independent organizations, or government agencies may supply them. Social services are linked to the notion of welfare and the benefits system, as countries with significant welfare programs frequently provide a variety of social services. Social services are used to meet a society's diverse demands. Prior to industrialisation, its delivery of social services was mostly confined to private organizations and charities, with the scope of its coverage also constrained. Welfare benefits are now widely viewed as a "necessary function" of society and a tool via which governments can solve societal challenges.

Learn more about challenges here

https://brainly.com/question/18027796

#SPJ4

Does student led prayer violate the Establishment Clause?

Answers

The significance of keeping government and religion separate was cited by the Supreme Court in its decision that the prayer led by the school violated the First Amendment.

Does the establishment clause have any bearing on the debate over prayer in public schools?

Vitale, the US Supreme Court ruled that prayer in public schools was unlawful, even if it was voluntary. The court particularly found that this prayer violated the First Amendment's prohibition on the state creating religion. The Establishment Clause of the First Amendment states that no laws "respecting an establishment of religion" may be passed by the government. This clause forbids the establishment of an official religion by the government.

Why is the Establishment Clause against school prayer?

However, in the 1960s, the American Supreme Court began to forbid adult-led prayers in public schools. The First Amendment's establishment clause was allegedly broken by these activities because they established a state-sanctioned religion, in most cases Christianity.

To learn more about First Amendment visit :

https://brainly.com/question/1078243

#SPJ4

What are the positive impacts of westernization?

Answers

The positive impacts of westernization is:

Increased access to technology and education.Improved infrastructure.Increased economic development.

The Benefits of Westernization: Improved Technology, Infrastructure, and Economic DevelopmentIncreased access to technology and education: Western cultures have brought technological advancements to the countries they have influenced. This has improved access to education and has allowed for more interactive and efficient learning techniques.

Improved infrastructure: Western countries have been able to invest in infrastructure, such as roads, railroads, and airports, which has allowed for easier transportation and a better quality of life in the countries they have influenced.

Increased economic development: Westernization has also allowed for better trade opportunities and improved economic development in the countries that have been influenced.

Better health care: Western countries have been able to provide access to better health care, which has improved the overall health of those countries.

Increased cultural exchange: Westernization has allowed for increased cultural exchange, allowing people to learn more about the culture of other countries and to share their own culture.

Increased job opportunities: Westernization has allowed for more job opportunities in the countries it has influenced, which has improved the quality of life for many people.

Learn more about westernization at: https://brainly.com/question/19194121

#SPJ4

describe any four functions of bank​

Answers

Answer:

accepting deposits, granting loans, advances, cash, credit,

in what european country are children given gifts by st. basil on january 1st instead of santa on december 25th?

Answers

European country where children are given gifts by st. basil on january 1st instead of santa on december 25th is Greece.

In Greece, the most compelling religion is Greek Universality, which is essential for Eastern Conventional Christianity where Christmas Gift ois given on 1st January in place of 25th december.. Greek Universality has its foundations in Early Christianity in the Close to East and the Byzantine Domain - which is depicted as the middle age history of Greece. The customary gift-carrier in Greece must be a compelling figure from Byzantine history.

Youngsters in Greece are seldom approached to leave a treat for St Basil, as in different societies, and it isn't clear how the gift-bearer goes all over the planet. A fascinating reality here is that the tale of the western St Nick Claus, Holy person Nicholas, showing up on a flying sled most likely begins in old Greece and the fantasy of the flying chariot god, Helios (the Sun). In any case, in the Greek Conventional practice, it is prophet Elias, not St Basil, who picked this technique for transportation.

Hence,correct answer is Greece.

To know more about Christmas gift, visit here:

https://brainly.com/question/7365300

#SPJ4

debbie is asked to describe the smell of grass. while she immediately remembers what grass smells like, she also realizes she is thinking about the first time she ever mowed the lawn growing up. what type of memory is mowing the lawn for debbie in this case? select an answer and submit. for keyboard navigation, use the up/down arrow keys to select an answer. a semantic memory b episodic memory c procedural memory d echoic memory

Answers

Debbie is asked to describe how grass smells. While she quickly recalls how grass smells, she also understands she is recalling the first time she ever mowed the lawn as a child. In this scenario, Debbie's procedural memory is mowing the grass.

What is procedural memory?

Procedural memory is a sort of implicit memory that helps people complete certain tasks without being aware of their past experiences.

Procedural memory controls our actions and is typically found below the level of conscious awareness. When necessary, procedural memories are automatically recovered and used to carry out the integrated procedures required in both cognitive and motor abilities, such as tying shoes, reading, and piloting an airplane. Procedural memories can be accessed and used without requiring conscious control or attention.

To learn more about procedural memory, click

https://brainly.com/question/16050083

#SPJ1

Other Questions
16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation? Is there a closed economy? A, B, C and D are points on the circumference of a circle, and the center is O. AC is the diameter of the circle. AC and BD intersect at E. Which point would map onto itself? Write a rule for the reflection.(x,y) = ( , ) suppose a collection of five batteries is connected as shown in the figure, in which b1 = 4.1 v.