what is the person's ultimate search in life? why?​

Answers

Answer 1

Answer: The ultimate purpose of life is to be at a higher positive frequency than negative, as you move through the vicissitudes of life, such that you feel content at the moment of death.

Contentment at the moment of death ensures that you reconnect to your positive soul self after death, review soul lessons, heal and recuperate.

If you are not content at the moment if death , you may get lost in an invisible maze of difficulties, as a spirit in a human form and gave a difficult after life & /or next life. .. To be content at the moment of death requires several years of training in detachment, meditation and positive thinking, through life.

Explanation:


Related Questions

Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help

Answers

A :) lllllllu fluctuating

What are examples of devices that use electromagnetic waves? Check all that apply.


-FM radios
-microwaves
=TV remote controls

Answers

Answer:

FM radios and TV remote controls.

All of the following would result in a population increase except

- a high rate of immigration
- a higher death rate than birth rate
- a low rate of emigration
- a low birth rate

Answers

Answer: B

Explanation: because birth and immigration is making the group bigger zero deaths and animals leaving
Hope this helps.

The answer I would choose is a low birth rate.

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

Answers

Answer:

the phenotype of a mouse with genotype is g

Which of the following correctly describes a graded potential?

Answers

Answer:

Graded potentials are changes in membrane potential that vary in size, as opposed to being all-or-none.

Explanation:

btw, where are the options?

The statement which correctly describes a graded potential is: amplitude of various sizes.

Graded potential refers to a temporary change in electric or membrane potential of a stimulus with respect to both its size and distance.

Amplitude can be defined as the maximum displacement of a wave when measured from its equilibrium position.

Thus, amplitude is measured vertically from an equilibrium position.

Generally, a graded potential is directly proportional in amplitude to the size of the stimulus that is send as an input due to the following:

DepolarizationHyperpolarization

In conclusion, the statement which correctly describes a graded potential is amplitude of various sizes.

Read more on graded potential here: https://brainly.com/question/25377211

A biological factor that is correlated with borderline personality disorder is:
a)
a high level of testosterone.
b)
a low level of serotonin.
c)
a high level of serotonin.
d)
a low level of testosterone.

Answers

A low level of testosterone

Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin

Answers

Answer:

Nervous system signal conduction in muscular movement

Explanation:

Hope i helped :)

Distinguish between dimorphic, polymorphic, and continuously variable traits.

Answers

Dimorphic, polymorphic, and continuously variable traits are distinguished as follows:

Dimorphism is the condition of those species of animals or plants that exhibit two anatomical aspects or two different forms.

When talking about polymorphisms in genetics, reference is made to the different variations that may exist on the DNA of the same gene.

Continuously variable traits are those that show a continuous distribution of phenotypes.

Therefore, we can conclude that dimorphism is a polymorphism with only two forms, the polymorphism is any stable change of the DNA fixed in the population and in continuously variable traits the phenotypes show a continuous series and cannot be easily grouped.

Learn more about polymorphic traits here: https://brainly.com/question/7882029

water vapor present in air support water cycle

Answers

yes because water is obviously present in the water cycle therefor water is carried up thanks to the air to form a cloud

Where does carbon dioxide come from during photosynthesis?

Answers

Answer:

Plants extract the carbon dioxide from the air and use it in photosynthesis process to feed themselves.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Which indicates a heterozygous genotype for smooth pods?

A. ss
B. SS
C. Ss​

Answers

Answer:

C. Ss

Explanation:

One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.

in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze

Answers

The cas because they are not vegan and they are not good enough for me and I’m not like that what

Scientists can determine the exact age of a fossil by how much carbon is left in the fossil. This is called

Question 9 options:

Both of these


None of these


Relative dating


Radiometric dating

Answers

Scientists can determine the exact age of a fossil by a technique called  Radiometric dating. Radiocarbon dating involves the determination of how much carbon is left in the fossil.

In radiocarbon dating, it is possible to determine how much carbon is left in the fossil, by looking at its half-life period.

Radiocarbon dating (also known as carbon dating) refers to the technique aimed at determining the age of a fossil by exploring the properties of a radioactive carbon isotope called radiocarbon.

Radiocarbon or carbon-14 (14C) is a radioactive carbon isotope of carbon that contains 6 protons and 8 neutrons, whose amount in a sample can de be used to determine the age of a given organic material.

Learn more about radiocarbon here:

https://brainly.com/question/12693872

A scientist recently discovered a pond organism that is unicellular, contain
other membrane-bound organelles, and possesses a flagellum. In which ki
organism classified?
Fung
Monera
Plant
Protista

Answers

A pond organism that is unicellular, contains membrane-bound organelles and possesses a flagellum is a PROTISTA. It is a unicellular kingdom.

The Protista kingdom is composed of eukaryotic single-celled unicellular organisms.

Flagellated protists are microorganisms having a tail-like projection known as flagellum.

The flagellum is a structure used for motion, thereby, in general,  flagellated protists are found in moist environments (e.g., ponds, fresh-water, etc).

Learn more about the Protista kingdom here:

https://brainly.com/question/5186929

more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell

Answers

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

Answers

Answer: B

Explanation:

Answer:

I think A! Sorry if wrong!

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

Answers

BB - brown nose, Bb - brown nose bB - brown nose and bb - blue nose.

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Answers

Answer:

the first one

Explanation:

.

14. The active site of an enzyme

a. Is where the semi-permeable membrane is located

b. Is a specific bulge of protuberance on an enzyme

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits

d. Rigidly resists any alteration of its shape

Answers

Question:-

The active site of an enzyme

a. Is where the semi-permeable membrane is located

b. Is a specific bulge of protuberance on an enzyme

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits

d. Rigidly resists any alteration of its shape

Answer:-

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits.

Explanation:-

The active site is one such gap or pocket to which the substrate adapts and binds to the enzyme.

The active site is the region of the enzyme to which the substrate molecule binds and causes a chemical reaction. The active site is composed of amino acid residues that form a temporary bond with the substrate.

why are the offspring of coral identical to the parent

they reproduce sexually so offspring have increased genetic variation

they reproduce asexually so offspring have increased genetic variation

they reproduce sexually so offspring have decreased genetic variation

they reproduce asexually so offspring have decreased genetic variation

Answers

Answer:

they reproduce asexually so offspring have decreased genetic variation

Explanation:

when an organism reproduces asexually, its offspring will look identical to the parent due to the offspring only receiving genes from one parent. I hope this helps!

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

Answers

Answer:

B-Close the ring in the bearing or the ring in the bearing.

Explanation:

hope it's help

The correct answer would be (B) close the ring in the bearing or the ring in the bearing

Hope this helps! Merry Christmas to you all!!!

Help help bell help help

Answers

6 units
because it is decreasing by three every time

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Answers

Answer:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Explanation:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Identify the animal products and by-products you use throughout an entire day, and log them in a journal. Submit your journal and your reflection.

Answers

Answer: Products from animals include meat and meat products, poultry products (meat and eggs), fish, shellfish, dairy products (milk and cheese), and non-food products such as fiber (wool, mohair, cashmere, and leather).

Explanation:

pls help click the link answer​

Answers

Answer:

1. Transfer

2. Share

3. Subscript

4. Positive

Other Questions
The mode of the data in the table is because it. The range of data in the table is. To determine the range of data, subtract three from the number of electoral votes for. What are some characteristics for consequences? So this is the situation, i want to write a story for my Family, But i need ideasThank u guys list 5 benefits of goverment from sport Find the value of f(7).y = f(x) The area of a rectangle is 52 in^2. If the length is 9 inches more than the width, find thedimensions of the rectangle. basically how to write y-3=4(x+2) in slope intercept form A line includes the points (-7, 1) and (7, -1). What is its equation in slope-intercept form?Write your answer using integers, proper fractions, and improper fractions in simplest form. what is 1,625 if you write it as a mathematical fraction? in simplest terms: (-5x-7)-(-4x-6)(5x7)(4x6) In 1776, most people believed that their human rights came from: nature the government themselves God What are common ways for pathogens to spread from person to person? (2 points) There is a bag with only red marbles and blue marbles. The probability of randomly choosing a blue marble is59. There are 45 marbles in total in the bag and each is equally likely to be chosen. Work out how many red marbles there must be. In the New York marathon there were 45 360 runners. 7 /10 of the runners were women. How many of the runners were men? Individuals that are better suited to their environment are likely to have more offspring and pass their genetic material onto future generations. This theory is referred to as ____. Question 1 options:Use and Disuse Endosymbiosis Evolution Natural Selection Ilana has 70 in her purse. All the coins have the same value. What could describe all the coins she has in her purse?71 pennies8 dimes14 nickels3 quarters If the forces acting on an object at rest are ______,the object will remain at rest. How do you find the inverse of the exponential growth function?f(x)=9.16(1.0054)^xI know the inverse of an exponential is the log but the function is not in the exponential form and I am not sure how to find c D5. In all organisms, the coded instructions for specifyingthe characteristics of the organism are directlydetermined by the arrangement of theA) twenty kinds of amino acids in each proteinB) twenty-three pairs of genes on each chromosomeC) stands of simple sugars in certain carbohydratemoleculesD) four types of molecular bases in the genes do plants need oxygen to make sugar?