What is the solution to -1-7?
BRE
--10-9-8-7-6
0
1
2
3
4
5
Б
7
8 9 10
-6
Оооо,
6

What Is The Solution To -1-7?BRE--10-9-8-7-601 234578 9 10-6,6

Answers

Answer 1

Answer:   -8

Step-by-step explanation: hope this helps=)


Related Questions

Se desea construir un parque con forma de sector circular con un radio de 402 pies y un ángulo central de 45°. ¿Cuál será la superficie ocupada por dicho parque?

Answers

Answer:

63462 pies

Step-by-step explanation:

De la pregunta anterior, debemos encontrar el área del sector

La fórmula se da como:

θ / 360 × πr²

Dónde:

θ = 45 °

radio = 402 pies

Área del sector =

45/360 × π × 402²

= 63461.742399 pies

Aproximadamente el área de la ocupada por el parque = 63462 pies

Find the area of this triangle.
Round to the nearest tenth.
7 m
125°
14 m
?] m2
Enter

Answers

Answer:

40.1

Step-by-step explanation:

i just did it and got it right

In a certain arithmetic sequence, if -4 is the first term and 10 is the third term, which term is 157?

Answers

Answer:

a₁₅₇ = 1,088

Step-by-step explanation:

aₙ = a₁ + d(n-1); where 'd' if common difference

a₁₅₇ = -4 + 7(156)

      = -4 + 1092

      = 1,088

Answer:

157 is the 24th term

Step-by-step explanation:

The formula for arithmetic sequences is an=a1+(n-1)d,

where an is the nth term, a1 is the first term, n is the term position, and d is the common difference

First, we need to find the common difference using the 10.

Since it's the third term, we have 10=-4+(3-1)d

Solving for d gives us d=7

Next, we need to find the term number of 157

Thus, we have 157=-4+(n-1)*7

Solving for n gives us n=24

We can check it like this: Following order of operations (i.e. PEMDAS) gives us 24-1=23*7=161-4=157

58:36
If Zöe orders a book from Store Y, how much tax will she pay?
Comparison of Online Bookstores
Store X
Store Y
Cost of book
$17.00
$18.00
Tax rate
6%
8%
Shipping
10% of cost before tax
FREE
$1.44
$2.25
O $12.25
O $14.40

Answers

Answer:

$1.44

Step-by-step explanation:

Tax is a compulsory sum levied by the government. it increases the price of the good

tax paid = tax rate x price of the book

18 x 8%

18 x 0.08 = $1.44

PLEASE I NEED THE ANSWER WITH THE EXPLANATION DON'T IGNORE MY QUESTION!!!
The
mean of six numbers is 12.five of the numbers
are 11,7,21,14 and 9. calculate the sixth number.​

Answers

The answer is attached. I hope this helps answer your question!

Answer:

10

Step-by-step explanation:

data=11,7,21,14,9,x

mean=sum of data/no of data

12=11+7+21+14+9+x/6

12*6=62+x

72-62=x

10=x

therefore sixth number is 10.

A city has 18 radio stations, including 4 college radio stations.
What is the probability that a randomly chosen radio station in this city is a college radio
station?
Write your answer as a fraction or whole number.

Answers

Answer:

2/9

Step-by-step explanation:

P=4/18=2/9

Thank you everyone for helping me this year to get good grades I am giving points.​

Answers

Yayyyy I’m so happy you got good grades

Alex bought 2 printer cartridges for $28 each and a printer for $85. He gave the cashier $150. How much change should Alex have received from the cashier?

Answers

Answer:

$9 in change

Step-by-step explanation:

Find the total cost of his purchases:

28 + 28 + 85

= 141

Find how much change he received by subtracting this from 150:

150 - 141

= 9

So, he should have received $9 in change

Michael has 2 hats, 3 shirts, and 8 pants. How many different ways can he wear the outfits if he wears one of each?

Answers

Answer:

2

Step-by-step explanation:

a straight line has equation y=5-3x
what is the gradient of the line?

Answers

Answer:

-3

Step-by-step explanation:

1. rearrange so it's in the formula y=mx+C

2. y=-3x+5

y=mx+C

M=gradient

-3=m

gradient= -3

Round 31.24 to 1 decimal place

Round 5.275 to 2 decimal place

Round 0.56489 to 3 decimal place

Answers

Answer:

1. 31.2

2. 5.28

3. 0.565

Step-by-step explanation:

Remember if the number is 1-4 round down and if the number is 5-9 round up.

Hope this is helpful

#happylearning

Find the missing side of the triangle. Round your answers to the nearest tenth if necessary.


12.4 in

3.1 in

16.7 in

11.2 in

Answers

Answer:

3.1 in

Step-by-step explanation:

a² + b² =c²

12=c

11.6=b

c²- b² = a²

12²-11.6²= 9.44

√9.44 = 3.07 Rounded = 3.1 in

Figure 2 was constructed using figure 1. For the transformation to be defined as a rotation, which statements must be true? Selext three options.

Answers

Answer:

The segment connecting the center of rotation, C, to a point on the pre-image (figure 1) is equal in length to the segment that connects the center of rotation to its corresponding point on the image (figure 2).

The transformation is rigid.

Every point on figure 1 moves through the same angle of rotation about the center of rotation, C, to create figure 2.

If figure 1 is located 360° about point C, it will be mapped onto itself.

Step-by-step explanation:

please help meeeeeeee​

Answers

https://youtu.be/QnydfcNVJoQ

sypport my channel pls pls

channel name sabrina clodia

Answer:

x + y = 60

Step-by-step explanation:

[tex]2x + 2y + 60 = 180 \\ 2x + 2y = 180 - 60 \\ 2x + 2y = 120 \\ \frac{2x + 2y}{2} = \frac{120}{2} \\ x + y = 60 \\ [/tex]

what is 2/3 of 4 hours and 30 minutes?

Answers

The answer is 3 hours

Help me this is due soon

Answers

Answer:

It's (-1.5,-5.5)

Step-by-step explanation:

Answer:

-1.5 , -5.5

Step-by-step explanation:

A circle in the standard (x,y) coordinate plane has
center C(−1,2) and passes through A(2,6). Line
segment AB
___ is a diameter of this circle. What are the
coordinates of point B ?

Answers

Given:

Center of a circle is at point C(-1,2).

AB is the diameter of the circle.

Coordinates of the point A are A(2,6).

To find:

The coordinates of point B.

Solution:

Let the coordinates of point B are (a,b).

If AB is the diameter of the circle, then A and B are end points of diameter of the circle and the center C is the midpoint of AB.

[tex]Midpoint=\left(\dfrac{x_1+x_2}{2},\dfrac{y_1+y_2}{2}\right)[/tex]

Point C = Midpoint of AB

[tex](-1,2)=\left(\dfrac{2+a}{2},\dfrac{6+b}{2}\right)[/tex]

On comparing both sides, we get

[tex]\dfrac{2+a}{2}=-1[/tex]

[tex]2+a=-1\times 2[/tex]

[tex]a=-2-2[/tex]

[tex]a=-4[/tex]

Similarly,

[tex]\dfrac{6+b}{2}=2[/tex]

[tex]6+b=2\times 2[/tex]

[tex]b=4-6[/tex]

[tex]b=-2[/tex]

Therefore, the coordinates of point B are (-4,-2).

Move triangle ABC so it lies on top of triangle DEF, triangle GHI, and triangle JKL. How many units do you have to move triangle ABC from its original location to coincide with each of the other triangles? Specify how triangle ABC moves up, down, left, or right.

Answers

Answer:

See explanation

Step-by-step explanation:

The question is incomplete, as the diagram of coordinates of the three triangles are not given.

A general explanation is as follows:

First, record the coordinates of the corresponding points of the three triangles.

For instance; In triangles ABC, DEF and GHI; A, D and G are corresponding points.

Now, assume the coordinates are:

[tex]A = (1,1)[/tex]

[tex]D = (1,5)[/tex]

[tex]G= (-2,1)[/tex]

Point D is 4 points to the right of A;

i.e.

[tex]D =(1,1+4) = (1,5)[/tex]

Hence, ABC will be moved 4 units right to lie on DEF

Similarly, point G is 3 units down of A

i.e.

[tex]G =(1-3,1) = (-2,1)[/tex]

Hence, ABC will be moved 3 units down to lie on GHI.

a rectangular lawn of dimensions 6x metres by x metres. In the centre is a rectangular flower bed of length (x + 4) m and width (x - 1) m. If the area of the shaded region is 40 m’, calculate the area of the flower bed.​

Answers

Answer:

The area of flower bed is 8.96 m^2.

Step-by-step explanation:

Length of lawn = 6 x

width of lawn = x

length of flower bed = x + 4

width of flower bed = x - 1

Area of shaded region = 40 m^2

Area of the shaded region

6 x (x) - (x +4)(x -1) = 40

[tex]5 x^2 - 3 x - 36 = 0 \\\\x = \frac{-3\pm\sqrt{9 + 720}}{10}\\\\x = \frac{-3\pm 27}{10}=2.4 m, - 3 m[/tex]

As length cannot have negative value, so x = 2.4 m.

Area of flower bed = (x + 4)(x - 1) = (2.4 + 4)(2.4 - 1) = 8.96 m^2

Helen draws a random circle
she then measures it diameter

Answers

Answer:

Lower Bound = 2.996

Upper bound = 3.244

Step-by-step explanation:

i need helppp helpp me pleaseeeee!!

Answers

Answer:

y = 6

Step-by-step explanation:

Answer:

i helped

Step-by-step explanation:

Find the range and the interquartile range of the given data set.
2, 4, 7, 8, 16, 19, 21

Answers

The range for the data given is 11

Two amounts of money are in the ratio 8:3 if the second amount is 4.05,what is the value if the first amount?​

Answers

Answer: 10.75 currency units

Step-by-step explanation:

The amounts of money are in the ration 8:3 which means that for every 3 units of the second amount, there are 8 units of the first.

Use direct proportion to solve:

8      :      3

x      ;       4.03

Cross multiply to get:

3x = 32.24

x = 32.24 / 3

x = 10.75 currency units

If 0(0,0), B(5,0) and C(5,5) are three points. Prove that
OB=OC.​

Answers

Step-by-step explanation:

you must have written something wrong.

because given that information OB is not equal to OC.

but for example, OB = BC.

the distance of OB is (5,0) - (0,0) = (5-0,0-0) = (5,0) =

= sqrt(5² + 0²) = sqrt(25) = 5

the distance of OC is (5,5)-(0,0) = (5-0,5-0) = (5,5) =

= sqrt(5² + 5²) = sqrt(50) = 5×sqrt(2)

so, OB is NOT the same as OC.

but BC is (5,5)-(5,0) = (5-5,5-0) = (0,5) = sqrt(0² + 5²) =

= sqrt(25) = 5

what equation do I use to find the apothem?

Answers

Answer:

10

Step-by-step explanation:

Answer:

10

Step-by-step explanation:

the sum of 43.9 and 4 groups of a number​

Answers

Answer:

10.975+10.975+10.975+10.975

Step-by-step explanation:

Here are the equations of two different graphs: y = x-7 and y = 3x - 7 Are the gradients of the graphs the same or different? Explain how you know.


help please ​

Answers

Answer:

this two graph is not same because they have different slopes for this they are not same

The breakdown of a sample of a chemical compound is represented by the function p(t) = 500 (0.25)^t, where p(t) represents the number of milligrams of the substance and t represents the time. In years. In the function p(t), explain what 0.25 and 500 represent.​

Answers

Given:

The function is:

[tex]p(t)=500(0.25)^t[/tex]

Where p(t) represents the number of milligrams of the substance and t represents the time.

To find:

The correct explanation for the number 0.25 and 500 in the given function.

Solution:

The general exponential function is:

[tex]y=ab^x[/tex]           ...(i)

Where, a is the initial value and b is the growth/decay factor. If [tex]0<b<1[/tex], then decay factor and if [tex]b>1[/tex], then growth factor.

We have,

[tex]p(t)=500(0.25)^t[/tex]           ...(ii)

On comparing (i) and (ii), we get

[tex]a=500[/tex], it means initial there are 500 milligrams of the substance.

[tex]b=0.25[/tex], this value is less than 1, it means the substance is decreasing by a factor of 0.25.

Therefore, 0.25 means the substance is decreasing by a factor of 0.25 and 500 means the initial value of substance is 500 milligram.

Hey!! Can you guys help me !!

No links!!
No spams!!

Ahmed paid $34 000 for a car. His car decreased in value by 40% at the end of the first year. The value at the end of the second year was 10% less than the value at the end of the first year. . Calculate the value of Ahmed's car after 2 years .​

Answers

First step:

40% of 34 000

40/100 * 34 000 = 13 600

subtract : 34000 - 13 600 = 20 400

Second step:

10% of 20 400

10/100 * 20 400 = 2040

subtract : 20 400 - 2040 = $ 18 360

Final Answer = $ 18 360

which of these points lies on the circle with center (2 3) and radius 2

A. (4,3)
B. (3,4)
C. (-1,0)
D. (1,3)

Answers

Answer:

A. 4,3

Step-by-step explanation:

that's it thanks brainliest please

Answer:

A) (4,3)

Step-by-step explanation:

Other Questions
Please help I will give you Brainlyest HelpHelpHelpHelpHelpHelp Write two simple sentences about education a/ one sentence using one subject and two verbs b/ one sentence using two subjects and two verbs Peter work three more days than jill. Peter earn $20 day jill earn $40 day. But they earned the same amount of money Which of the following is an equivalent trig ratio for tan 28Cos 621/ tan 621/ tan152Cos 28 The answer choices are spelling rules about what to do before adding suffixes to a base word that ends in a consonant. Identify the rule that was applied to the word below.benefit + -ingDo not double the final consonant if the suffix begins with a consonant.If a base word has three or more syllables, do not double the final consonant.If a base word ending in one consonant has two syllables, and the second syllable gets the accent, double the final consonant.If a base word ends in more than one consonant, just add the suffix without changes.If a base word has only one syllable and ends in one consonant, double the final consonant.If a base word ending in one consonant has two syllables, and the first syllable gets the accent, do not double the final consonant. two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?A whether the producers are located on land or in waterB whether or not the food web includes tertiary consumersC whether the web includes animals that migrate during the yearD whether the ecosystem described by the web is localized or very broad two particles woth each charge magnitude 2.010^-7 c but opposite signs are held 15cm apart.what are the magnitude and direction of the electric field E at tge point midway between charges Subordinate Conjunctions make a _______ clause not be able to stand on its own. PLEASE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP please help please help the tRNA for GUCAUCGAUCGAUCGGAUGCC A red light flashes every 6 seconds A yellow light flashes every 4 seconds They both flash at the same time.After how many seconds will they next both flash at the same time? The radius of a right circular cone is increasing at a rate of 1.1 in/s while its height is decreasing at a rate of 2.6 in/s. At what rate is the volume of the cone changing when the radius is 107 in. and the height is 151 in. The elements in a long array of integers are roughly sorted in decreasing order. No more than 5 percent of the elements are out of order. Which of the following is the best method to use to sort the array in descending order?I. Insertion sort.Il. Merge Sort.III. Heap Sort.a. Ill only.b. I only.c. II and III only.d. I and II only.e. Il only I and.f. Ill only. Help please I asp !!! For A = R + PRT/100 make P the subject. 1. What are metabolic wastes?2. Which are the main organs of the excretory system? please help me with this The practice of selling indulgences troubled many Catholics because the practice made it seem like? Which sentence in the paragraph is structured differently than the others?