What was the Alien act of 1798 in simple explanation?

Answers

Answer 1
Alien Enemies Act permitted the government to arrest and deport all male citizens of an enemy nation in the event of war, while the Alien Friends Act allowed the president to deport any non-citizen suspected of plotting against the government

Related Questions

Happy Earth day everyone!

Answers

Answer:

Happy Earth Day! The drawing is so cute!!

Explanation:

Answer:

Thankyou! You as well!

Washington farms struggled to meet demand for crops during the war because
several years of drought crippled the state.
male workers from rural areas were drafted.
workers from Mexico were hard to recruit.
farmland was converted into military bases.

Answers

Maps oh hide Ghhhhhuuuuuuuuu

1)In what ways were the amendments a success?


2)In what ways have the amendments failed to actually offer equality? ( Think outside the box-think about what you KNOW about racial struggles in the US from then to NOW!)

Answers

Answer:

When a State ratifies a proposed amendment, it sends the Archivist an original or certified copy of the State action, which is immediately conveyed to the Director of the Federal Register. A proposed amendment becomes part of the Constitution as soon as it is ratified by three-fourths of the States (38 of 50 States).

What was one reason why the equal rights amendment failed? Fewer women wanted to enter the workforce by the 1970s. Only seven states ratified the amendment in the allotted time. Many people feared potential unintended effects of the amendment because it was vaguely worded.

Explanation:

please mark this answer as brainlest

A. What’s different when there are elections for U.S. Congress? Candidates for the Senate and House of Representatives have a smaller audience for the campaigns, since they are elected by districts within a specific state. Congress also goes back to work earlier than the President. How do the processes compare? Using this information and what you learned in the lesson, complete the Venn diagram with the letters from the list.

Answers

Answer: a meal

Explanation:

In a Venn diagram comparing the election of U.S. Congress and the Presidency, the following differences and similarities could be included:

Both involve campaigning and voting by the American people
Both involve choosing representatives to make decisions on behalf of the public
Candidates for Congress are elected by districts within a specific state, while candidates for the Presidency are elected by the entire country
Congress goes back to work earlier than the President after the election
The President has more power and influence than individual members of Congress.

Pizarro and Diego de Almagro sailed south from Panama. They faced many obstacles. How did Hernando de Soto save them?
A. De Soto defeated King Charles.
B. De Soto found a way to Asia.
C. De Soto brought supplies.
D. De Soto sank an enemy ship.

Answers

Answer:

Explanation:

B

B!!
Hope this helped!

What should a body paragraph in an informative essay include? Check all that apply.

a hook
evidence
a summary
a topic sentence
a thesis statement
a restatement of the thesis

Answers

evidence, summary pretty << sure that’s it based on what i know.
A topic sentence and evidence.

who ever gets this right will get a brainlest and a good rating

Answers

Answer:

asia

Explanation:

Answer:

Asia

Explanation:

Because that is were spanish travel was centered around.

Who was the Confederacy’s primary trading partner during the Civil War?

Answers

The Confederacy’s primary trading partner was England. They traded cotton bails

What was the Great act referred to by Senator Sumner?

Answers

The "great act" referred to by Senator Sumner in this excerpt is "The addition of Hiram Rhodes Revels to the U.S. Senate."

What Senator Charles Sumter said in 1870 was the following: "All men are created equal, says the great Declaration and now a great act attests this verity. Today we make the Declaration a reality. ... The Declaration was only half established by Independence. The greatest duty remained behind. In assuring the equal rights of all we complete the work."

Hiram Revels became the first African American to enter the Senate of the United States Congress when the Republicans supported him on February 25, 1870.

Answer:What Senator Charles Sumter said in 1870 was the following: "All men are created equal, says the great Declaration and now a great act attests this verity. Today we make the Declaration a reality. ... The Declaration was only half established by Independence. The greatest duty remained behind. In assuring the equal rights of all we complete the work."

Hiram Revels became the first African American to enter the Senate of the United States Congress when the Republicans supported him on February 25, 1870.

Explanation:

HISTORY Guys please help summarize. Paragraphs are very short. I WILL GIVE BRAINLIEST

Answers

in Lincoln's gettys burgadress we hear him address the country in words of wisdom and encouragement. he reminds the people why the declaration was written,  (All people are created equal) and in the midst of this civil war this was a reminder of what they were fighting for.  the he mentions the people that have already laid down their lives on the battle field and says we as a country must never forget what they did and what they died for.  For the living must finish what they started and we must remember the sacrifice that they made so that me might live in freedom and not in tyranny.  


JhyhuiobgghjccgggcxWhj

I need help with this multiple choice question thing

Answers

Answer:

1. Was found in New England (Massachusetts)

2. Mostly female workers

3. Workers lived and worker in the same general location

4. Strict Moral Codes

5. Lowell System faded from the use beginning in the 1830s

Explanation:

She is correct!!! Yes

Can you please help me. answer the image

Answers

Answer:

13. Individual Rights

14. Checks and Balances

15. Popular Sovereignty

16. Separation of Powers

17. Republicanism

18. The Legislative Branch

19. The Executive Branch

20. The Judicial Branch

21. The Commander in Chief

22. The Supreme Law of the Land

23. Amendments

24. Federalism

25. Federalist

26. Antifederalist

27. The Bill of Rights

13 individual rights
14 checks and balances
15 popular sovereignty
16 separation of power
17 republicanism
18 the legislative branch
19 the executive branch
20 the judicial branch
21 the commander in chief
22 the supreme law of the land
23 amendments
24 federalism
25 federalist
26 anti federalist
27 the bill of rights

The transformation rule (x, y) → (`x/3`, `y/3`) is applied to the figure shown. Which are the final coordinates?
Select one:

1. (18,9),(–18,9),(–18,–9),(18,–9)

2. (9,9),(–18,9),(–18,–9),(9,–9)

3. (1,1),(–2,1),(–2,–1),(1,–1)

4. (2,1),(–2,1),(–2,–1),(2,–1)

Answers

oh pretty sure i did this last year if i’m not wrong it’s 3

During the early 1900’s, which event spurred the petroleum boom in Texas?

Answers

Answer:

1900's

Explanation:

1900's

Spindletop strike of 1901, at the time the world's most productive petroleum well ever found, to be the beginning point. This single discovery began a rapid pattern of change in Texas and brought worldwide attention to the state.

who ever gets this will get a brainlest

Answers

Answer:

people could buy forgiveness for their sins

Explanation:

Answer D: People could buy forgiveness for their sins

when is school out for u?

Answers

Answer: I think around May 20th or something like that.

Answer: I get out on June 5th or 6th

Explain the meaning of the term caste in Indian history.

Answers

Answer:The four primary castes are Brahmin, the priests; Kshatriya, warriors and nobility; Vaisya, farmers, traders, and artisans; and Shudra, tenant farmers and servants. Some people were born outside of (and below) the caste system; they were called "untouchables" or Dalits—"the crushed ones."

A defining feature of Hinduism, caste encompasses a complex ordering of social groups on the basis of ritual purity. A person is considering a member of the caste into which he/she is born and remains within the castle until death, although the particular ranking of that caste may vary among regions and over time.

Guys i have a 15% in history im not even playing rn help ORRR ima get a whoopin ahhh arab moms hit hard


The Battle of Gettysburg is considered to be a major battle because –


a
It marked a Union victory on Confederate territory that gave them control of the Mississippi River
b
It was the final location of Sherman’s March to the Sea.
c
It was a Union victory on Northern soil that was known as the turning point in the war.
d
Lee surrendered his troops to Grant immediately following the battle.

Answers

I’m pretty sure it’s C
the answer is C because it was the turning point of the Civil War trust me i’m in honors world history

I need help! so my class is doing a project in history where we have to make our own restaurant, but that's not the point i need someone to help me with a restaurant name. something simple but rustic something fancy but not to fancy, something to represent the columbian exchange through food

Answers

Answer:

delectable eating place or you may give delectable food hall

Explanation:

Pulitzer eats because it’s known for the Pulitzer Prize Yk ✨

Which of the following best describes a standing army?
A. It is made up of foot soldiers.
B. It is the special force that stands guard around the caliph.
C. It is maintained both in times of war and of peace.
D. It is stationed at outposts around the empire.

Answers

C. or B. Are the best answers

who ever gets this will get a brainlest

Answers

I'd say it's the first one. The reformation was a religious change, which makes the bottom three correct. However, the first one is wrong; if anything, they'd be less willing to challenge authority. This is because the government was playing what I like to call a government-issue version of whack-a-mole with authority challengers. As soon as one person started rebelling, the government would punish them, and another rebel is gone.

Answer:

The answer is C.

Hope that helps :)

Explanation:

Pizarro's forces took over and looted the Inca capital,
A. Cuzco.
B. Hispaniola.
C. Mexico City.
D. Panama.

Answers

It’s Cuzco! The Incas are from Peru, and Cuzco and its located in Peru

Answer:

Its C i believe. Dont quote me on it

:)

Explanation:

To my recollection the Inca is where Mexico City is today

the popularity of ______ increased as it became more affordable for consumers. a. radios b. cars c. houses d. televisions

Answers

i believe its radios

im not sure tho lol
It’s definitely cars.

How does Egypt's election system work?

Answers

Answer:

Egyptian presidential elections are held using a two-round system!

I honestly hope this helped!

a 2 round system is used in egypt

During the Great Depression, many rural Washingtonians relied on ______ to pay for goods and services.
stealing
begging
bartering
refinancing

Answers

Answer:begging

Explanation:sorry if im wrong i would suggest listening to the other person that anwsers.

Answer:

Stealing

Explanation:

The monetary contraction, as well as the financial chaos associated with the failure of large numbers of banks, caused the economy to collapse. Less money and increased borrowing costs reduced spending on goods and services, which caused firms to cut back on production, cut prices, and lay off workers.

scenairo 1: Sid comes to school every day and disrupts. Some of his referrals were for cursing at teachers, starting verbal altercations, throwing things at other students. He also yrllls down the classmates were unable to focus when he's around. The school documents the behavior and works to get the student removed. At one of the last meeting his mother insisted he had the right to a free public withdrawn from the school.

is sid's right to a free public education more important than the rights of the teachers and other students?

how is sid infringing on the rights of others?

Are sid's constitutional rights are being taken away?

Scenario2: It has been one week since the shooting at the Fort Lauderdale airport by a gunman. A high school baseball team is on their way to nationals in Ohio. while going through the security checkpoint, the trams captain jokes that his friend has a bomb, The TSA agent pulled the entire team into a room to question them about the bomb. The boys miss their flight to Ohio and miss the championship game.

is this high school student's right to freedom of speech more important than the rights of this teammates?

how is the team captain infringing on the rights of others ?

are the teams constitutional rights are being taken away?

Answers

Answer:

1. No his rights are not being taken

2. the team captain is in the wrong and his teammates have a grater right to freedom of speech

Explanation:

In scenario 1, Sid's right to a free public education is not more important than the rights of the teachers and other students to a safe and orderly learning environment. Sid's behavior is infringing on the rights of others by disrupting the class and making it difficult for them to learn. It is possible that his constitutional rights are being violated if the school is removing him from school without due process.

In scenario 2, the high school student's right to freedom of speech is not more important than the rights of his teammates to travel safely and participate in the championship game. The team captain's joke about a bomb infringed on the rights of others by causing them to miss their flight and potentially causing fear or anxiety among the other passengers and airport staff. It is possible that the team's constitutional rights were violated if the TSA agent detained them without probable cause.

When he raided Harper’s Ferry, John Brown hoped to –


a
provoke a slave rebellion
b
discredit Northern abolitionists
c
convince non-slaveholding Southerners to oppose slavery
d
frighten the North and South into negotiating a compromise on slavery

Answers

Answer:

The Harpers Ferry 'Rising' That Hastened Civil War On the evening Oct. 16, 1859, abolitionist John Brown led a raid he hoped would ignite a nationwide uprising against slavery.

Explanation:

So probably C

Brainliest Please

C.convince non slaveholding Southerns to oppose slavery

Please Help with this history question

Answers

Answer:

yes

Explanation:

Ya

who ever answers this will get a brainlest

Answers

Answer:

its the 2 one

Explanation:

It's the second one. He needed the money for the building

PLEASEEEE HELPPP DUE IN 30 MINITS !!

Answers

Missions and indigenous villages are commonly investigated contexts for indigenous responses to Spanish colonialism in the American Southwest. In early colonial New Mexico, colonists’ households were also a venue for interaction and exchange of information between Pueblos and Spanish. Using the concept of hybridity, I explore seventeenth-century Spanish ranches in northern New Mexico for the interactions between Spanish colonists and Pueblo wives, servants, slaves, and laborers. The architecture, foodways, and artifacts show an interplay between Pueblo and Spanish ways of making do suggesting that Pueblo peoples contributed in substantial ways to the nature of these households.

Other Questions
What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential