Why is it dangerous to wear contact lenses in the lab?

Answers

Answer 1

Answer:

Chemical vapors may penetrate the contact lens material and cause the lens to adhere to one's eye.

Explanation:


Related Questions

the term categorical perception refers to the fact that we are

Answers

Answer:

The term "categorical perception" refers to the fact that we are. better at hearing the difference between sounds from different categories than we are distinguishing sounds from the same category.

Explanation:

prepare a news report for a national daily about any social problems prevailing in your community

Answers

Answer:

Common Examples of Social Issues

Poverty and Homelessness

Climate Change

Overpopulation

Immigration Stresses

Civil Rights and Racial Discrimination

Gender Inequality

Health Care Availability

Childhood Obesity

Bullying

Poor Leadership

Explanation:

You are stopped at an intersection waiting to cross it. When checking for an opening in traffic the driver should:

Answers

You are stopped at an intersection waiting to cross it. When checking for an opening in traffic the driver should: Look left, right, left again.

Necessary precautions should be taken by a driver who seeks to enter an opening in traffic. This is important to avoid collisions with other road users.

When he looks left, right, and left again, this will ensure that there are no oncoming vehicles before he makes an entrance.

Learn more about traffic rules here:

https://brainly.com/question/1071840

in the book of leviticus, god tells what man not to shave his beard?

Answers

The answer to this question is Moses

what is an example of priesthood authority that was restored through the prophet joseph smith?

Answers

There are different example of priesthood authority. An example of priesthood authority that was restored through the prophet Joseph Smith  was the ordinance of baptism.

As a result of mortality, the priesthood is known to be the power and authority to act in God's name. With it , a person can given anybody an authorization to preach the gospel, give the ordinances and govern in the Church.

Joseph Smith was known to have been spoken to by God the Father and Jesus Christ in a vision and was said to have instructed him to restore the Church.

He stated that by being baptized, we as humans are following the commandment of the Savior and so therefore is the first saving ordinance of the gospel.

Learn more about Joseph Smith from

https://brainly.com/question/463692

How does a rubric like this help students over time? This rubric a. Tracks progress over several assignments c. Allows the teacher to comment on each section b. Identifies the criteria for each point value d. None of these.

Answers

The Rubric is a tool that help students over time by tracking their progress over several assignments.

What is a Rubrics?

A Rubrics states the set of criteria for performance and the detailed descriptions of each level of performance.

The rubrics is a tool that allows student to grade himself before he turns it in because he can see the marking scheme and know how many marks he is expecting.

Hence, the rubric is a tool that help students over time by tracking their progress over several assignments.

Therefore, the Option A is correct.

Read more about rubric

brainly.com/question/25916190

da answer is A  ......................................                                

You can use emails when you want to check in on the status of a project or communicate last-minute requests.

True
False

Answers

False, the answer is false

Answer:

maybe false

Explanation:

please mark me as the brainlist

Having a budget can be useless because there are always things that happen in life that change our budget.
O False
O True
Brainly has no answers for me plz help

Answers

Answer:

false

Explanation:

From which group did most military, church, and government leaders come?

Answers

Answer:

Muslims Religion played a major role in the American Revolution by offering a moral sanction for opposition to the British--an assurance to the average American that revolution was justified in the sight of God. As a recent scholar has observed, "by turning colonial resistance into a righteous cause, and by crying the message to all ranks in all parts of the colonies, ministers did the work of secular radicalism and did it better."Religion played a major role in the American Revolution by offering a moral sanction for opposition to the British--an assurance to the average American that revolution was justified in the sight of God. As a recent scholar has observed, "by turning colonial resistance into a righteous cause, and by crying the message to all ranks in all parts of the colonies, ministers did the work of secular radicalism and did it better."Ministers served the American cause in many capacities during the Revolution: as military chaplains, as penmen for committees of correspondence, and as members of state legislatures, constitutional conventions and the national Congress. Some even took up arms, leading Continental troops in battle.Religion played a major role in the American Revolution by offering a moral sanction for opposition to the British--an assurance to the average American that revolution was justified in the sight of God. As a recent scholar has observed, "by turning colonial resistance into a righteous cause, and by crying the message to all ranks in all parts of the colonies, ministers did the work of secular radicalism and did it better."Ministers served the American cause in many capacities during the Revolution: as military chaplains, as penmen for committees of correspondence, and as members of state legislatures, constitutional conventions and the national Congress. Some even took up arms, leading Continental troops in battle.The Revolution split some denominations, notably the Church of England, whose ministers were bound by oath to support the King, and the Quakers, who were traditionally pacifists. Religious practice suffered in certain places because of the absence of ministers and the destruction of churches, but in other areas, religion flourished.Religion played a major role in the American Revolution by offering a moral sanction for opposition to the British--an assurance to the average American that revolution was justified in the sight of God. As a recent scholar has observed, "by turning colonial resistance into a righteous cause, and by crying the message to all ranks in all parts of the colonies, ministers did the work of secular radicalism and did it better."Ministers served the American cause in many capacities during the Revolution: as military chaplains, as penmen for committees of correspondence, and as members of state legislatures, constitutional conventions and the national Congress. Some even took up arms, leading Continental troops in battle.The Revolution split some denominations, notably the Church of England, whose ministers were bound by oath to support the King, and the Quakers, who were traditionally pacifists. Religious practice suffered in certain places because of the absence of ministers and the destruction of churches, but in other areas, religion flourished.The Revolution strengthened millennialist strains in American theology. At the beginning of the war some ministers were persuaded that, with God's help, America might become "the principal Seat of the glorious Kingdom which Christ shall erect upon Earth in the latter Days." Victory over the British was taken as a sign of God's partiality for America and stimulated an outpouring of millennialist expectations--the conviction that Christ would rule on earth for 1,000 years. This attitude combined with a groundswell of secular optimism about the future of America to create the buoyant mood of the new nation that became so evident after Jefferson assumed the presidency in 1801.

Explanation:

Hope this helps you !!
christianity? a military order is a christian religious society of nights

It is impossible to adjust your personal time schedule once it is established. Please select the best answer from the choices provided T F.

Answers

The answer is False.

All cells have the ability to replicate. True of false

Answers

Answer

False they duplicate ,not replicate

Explanation:

Meaning they make another cell but they are always different

Colby is writing a personal narrative about the time his dog, Snickers, dug a hole under the fence and ran wild through the neighborhood.

Answers

Answer:

the answer is D

Explanation:

B/c I said so (and got it right on quiz)

As Colby calms a scared Snickers, who had wriggled into a crawl space underneath the neighbor's deck, Colby is writing a personal account of the time his dog, Snickers, dug a hole under the fence and ran amok across the neighborhood. Hence, (D) is right.

What do you meant by  personal narrative?

Life stories, which are related to the personal narrative, are the subject of Charlotte Linde's writing: "A person's lifetime narrative is made up of all the tales and related discourse units, such as justifications and chronicles, as well as the connections between them, that meet the following two requirements:

A point about the speaker, not a general statement about how the world is, is the fundamental judgment of the stories and related discourse units that make up the life story. The narratives and the discourse units they are linked to have broad reportability."

The parallels and distinctions between an autobiography and a life story are also mentioned by Linde:

Learn more about  personal narrative, from :

brainly.com/question/19214562

#SPJ3

which state is home to the craters of the moon national monument

Answers

Answer:

Idaho.

Explanation:

Task 2: Prepare a College Fair Presentation
Imagine that you are a recruiter for your college's philosophy department, and you are at the
philosophy booth at an educational college fair. You are trying to persuade new students to
the college into joining the philosophy program, and you only have a few minutes to convince
each passerby that they should fill out an application. Your task is to prepare a three-to
five-minute speech designed to interest new students in the realm of philosophy so that they
will sign up for your program. Be creative, and use what you have learned about the wide
field of philosophy to help you write your speech. You may also research the philosophy
programs at reputable universities to help you get more information for your speech.

Answers

Answer:

Philosophical study develops writing, reading, reasoning, re-thinking, adapting, learning, organizing and dialogue skills. In a fast-changing business and technological environment, these are abilities of great practical value.

Assessments of analytical, logical reasoning and critical thinking skills are prominently featured in standardized exams like the GRE, GMAT, MCAT and LSAT. Philosophy majors tend to fare exceptionally well on these exams.

Despite starting off behind better-earning majors at the beginning of their careers, philosophy majors on average out-earn seemingly more practical majors like business administration by mid-career.

Philosophy assists us in understanding what our own ideas are based on, and how they stand in relation to those of others when exploring complex issues.

Philosophy develops relevant skills like making and criticizing arguments, careful reading of complex texts, and clear, precise writing.

The really good doctors, engineers and scientists think deeply about their work and its effects on other people and the world. Philosophy classes offer the space to think, write and discuss one’s experiences broadly — not just the “how to?” but also the “why?” and the “why not?”

Philosophy provides concepts that apply to family, social and work situations — helping us recognize and respond to ethical issues in the real world.

To be an engaged citizen today requires an unprecedented degree of media and information savvy. Philosophy provides the tools to counter the distorting effects of advertising and propaganda on political and social discourses.

Philosophy classes present students with the challenge of confronting themselves, their values and their world — what it means to succeed, and why.

Philosophical study encourages critical thinking — an essential aspect of creativity and innovation in the workplace. This takes practice (and sometimes courage).

Explanation:

How is the status of population composition by occupation of Nepal in rural and urban area? Explain​

Answers

Answer:

They have lots of shops

Explanation:

So basically they have a lot of things and more peopel come

True or False? An object can have both kinetic and potential energy.

A : True
B : False

Answers

Answer:

True

Explanation:

This is true because an object can be up off of the ground while also moving around.

Answer:True

Explanation:

True; an airplane possesses kinetic energy as a result of its velocity, and potential energy as a result of its height.

Hey dumpling , I wish your online to see this message lelz ​

Answers

Answer:

I don't know what you're talking about

Explanation:

Im pretty sure this is for some one else, but MERRY CHRISTMAS

Give 2 advantages the Viking sailors had.

Answers

Answer: The addition of oars and sails gave Viking boats an advantage over all other watercraft of their day in speed, shallow draft, weight, capacity, maneuverability, and seaworthiness. Viking boats were designed to be dragged across long portages as well as to withstand fierce ocean storms.

Explanation:

Plz Help I will give 100 Points
Interpret the bottom half of the cross section below. Start with the Vishnu Schist and end with the Red wall Limestone.

Answers

Answer:

Whats the question?

Explanation:

Which direction did the ships sail to get from North America to Europe

Answers

east because it is going across the Atlantic ocean

Answer:

East because if they sailed west they would have hit asia.

Explanation:

Why did some colonists bring enslaved people to Texas?

Answers

Because it’s near the broader of the Mexico

what did the declaration of independence accomplish

Answers

It accomplished the goal of announcing the intent of the thirteen colonies to formally separate from Great Britain.

Who was part of the Midnight Ride?

A. George Washington

B. John Hancock and Samuel Adams

C. Paul Revere and William Dawes

D. Those paine

Answers

Answer:

C. Paul Revere and William Dawes

Explanation:

Paul Revere started the midnight ride and spread his message throughout the world. William Dawes also rode on his horse during the Midnight Ride to warn Samuel Adams and John Hancock about the British coming to arrest them.

Twas the night before christmas was originally published under what name?

Answers

The poem, originally titled "A Visit" or "A Visit From St. Nicholas", was first published anonymously on Dec. 23, 1823, in a Troy, New York newspaper called The Sentinel.

I apologize if this answer is unhelpful.

how does the florida constitution differ from the u.s. constitution and its amendments?

Answers

Answer:

Many state constitutions look very similar to the U.S. Constitution, including the Florida Constitution. 18. The U.S. and Florida constitutions have a similar structure; both documents have a preamble, articles and amendments. ... The U.S. Constitution has 7 articles while the Florida Constitution has 12 articles

of the following statements, which one best represents the role of the judicial branch of government?
The judicial branch tries government employees that are accused go committing a crime.
The judicial branch has the ability to declare a new law unconstitutional.
The judicial branch writes the bills that are then sent to the legislative branch
The judicial branch has a responsibility to ensure that the committee system functions properly

Answers

Answer: A

Explanation:

decides the constitutionality of federal laws and resolves other disputes about federal laws

A step-by-step procedure used to obtain a particular goal when in search for a problem’s solution is a(n) __________. A. Heuristic B. Algorithm C. Subgoal D. Equation Please select the best answer from the choices provided A B C D.

Answers

The name which is given to a step-by-step procedure used to obtain a particular goal when in search for a problem's solution is an:

B. Algorithm

According to the given question, we are asked to state the name which is given to a step-by-step procedure used to obtain a particular goal when in search for a problem's solution.

As a result of this, we can see that an algorithm is a series of well defined steps which a person or a computer would have to undertake in order to solve a problem

Read more about algorithm here:

https://brainly.com/question/24793921

PLEASE HELP PLEASE IM BEGGING YOU PLEASE IM LIITTERALLY CRYYING

Answers

Answer:

1. Ireland

2.England

3.Netherlands

4.Belgium

5.France

6.Spain

7.Switzerland

8.Italy

9.Greece

10.Austria

Explanation:

Answer:

I don't know what do u wnat

Explanation:

can u plz explean

Plz Help I will give 100 points
There is one of each type of unconformity in this diagram. Name at least one of each of them by indicating the layers that they are between.

Answers

show the diagram and i will help in the comments

how long does regular mail take from state to state 2021?

Answers

Answer:

2-9 days in the 48 contiguous states

Other Questions
If you are the driver or owner of a vehicle which is in a crash that is your fault and you are not. Malik jogged 2 miles in 20 minutes.What was his rate in miles per hour?10 miles per hour6 miles per hour23 mile per hour110 mile per hour the smallest division value of electronic balance Astatine-218 has a half-life of 1.6 seconds. If you begin with a 1.7 g sample of astatine-218, how much of the sample remains after 3.2 seconds? explain different users of computer in briefly? Find the area of the cuboid. The valence electrons of a krypton (Kr) atom in the ground state are located in theA. first energy level (shell).B. second energy level (shell).C. third energy level (shell).D. fourth energy level (shell). Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides? Pleaseeee help meee with this!!!!!!!!!!!! Norton Company purchased a building on January 2 by signing a long-term $480,000 mortgage with monthly payments of $4,500. The mortgage carries an interest rate of 10 percent. The amount owed on the mortgage after the first payment will be A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest Imagine you own a company that makes YOUR FAVORITE PRODUCT. Read the excerpt from a text about online learning. "Virtual schools were growing quite quickly," said Christina Martin, a policy analyst at the Cascade Policy Institute, a free-market think tank based in Portland, Ore. . . . The big issue, she said, was fairness. Some students have access to virtual schools because they have a learning coach to stay home with them, while others dont. Also, Internet connections can be costly, and not every family has one. And families have to pay for their own printing. . . . "An adult must stay with a child during the day and make sure theyre doing their work. " This information would best support a claim about students need for personal coaches. Internet supervision. High-tech gadgets. Equal access to technology.