Write a food chain from this food web with six trophic levels.

Link In Comments

Answers

Answer 1

Answer:

where is the link I didn't see in comments


Related Questions

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer:

what I don't understand what is the Ctcagt

Explain how photosynthesis and cellular respiration work together.

Answers

Answer:

photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

In which form food is stored in the leaves? Comment

Answers

the answer is starch

Explanation:

food is stored in the leaf in form of starch in plants

ILL GIVE BRAINLIST


Darren used the following soil triangle to identify a sample of soil as sandy loam.

Soil texture triangle. Clay soil is approximately 45 percent or less sand, 50 percent or more clay, and 40 percent or less silt. Silty loam soil is approximately 50 percent or less sand, 30 percent or less clay, and 50 percent or more silt. Sandy clay soil is approximately 45 to 65 percent sand, 35 to 55 percent clay, and 25 percent or less silt. Sandy clay loam soil is approximately 45 to 80 percent sand, 20 to 35 percent clay, and 35 percent or less silt.

Which description of soil likely allowed Darren to make this identification?

Mostly large particles, with a gritty texture, 60% sand, 10% clay, and 30% silt
Mostly large particles, with a smooth texture, 40% sand, 50% clay, and 10% silt
Mostly small particles, with a smooth texture, 10% sand, 50% clay, and 40% silt
Mostly small particles, with a smooth texture, 30% sand, 30% clay, and 40% silt

Answers

Answer: I'm not sure but i think it's Mostly small particles, with a smooth texture, 10% sand, 50% clay, and 40% silt

Explanation:

Soil Texture is defined as the proportion of sand, silt, and clay-sized particles, which make up the composition of the soil.

The description that matches Darren's identification is that most small particles, with a smooth texture, are 10% sand, 50% clay, and 40% silt.

The soil texture can be explained as:

1. Clay in soil texture refers to the mineral soil particles that are less than 0.2 millimeters in diameter. Clay soil is 40% or more clay, less than 45% sand, and less than 40% slit.

2. Silt in the soil texture has a high percentage of sand and it feels smooth, having smooth textures. This soil has a high percentage of clay.

3. Sand is the largest mineral particle, which consists of the coarsest particles. The particles feel gritty and have a diameter of about 0.05 to 0.002 mm.

Thus, the correct answer is Option C.

To know more about soil texture, refer to the following link:

https://brainly.com/question/8046058

Eukaryotic genomes have gene sequences that can code for more than one polypeptide sequence because _____.

Answers

Answer:

The  correct answer would be -A pre-mRNA becomes mRNA by cutting out different introns

Explanation:

During the process of the RNA splicing, pre-mRNA has several specific segments of sequence that are identified by the spliceosome and then removed from the pre-mRNA. Specific parts that are removed are known as introns and the parts that stuck to become mRNA are exons.

Gene sequences in the eukaryotic genome can code for more than one protein due to removing the different introns every time to become mRNA from pre mRNA.

An individual is heterozygous for a gene at a specific locus. ________ will have the same form of alleles at that locus after S phase.A. Sex chromosomes.B. Homologous chromosomes.C. Non-sister chromatids.D. Sister chromatids.

Answers

Answer:

D

Explanation:

Sister chromatids will have the same form of alleles at the locus after S phase.

This is because during the S phae of the cell cycle, sister chromatids are replicated in preparation for cell division. The replication process is quite accurate such that all the alleles present on the initial chromatids are also replicated on the new sister chromatids. Hence, both new and old chromatids will have the same form of alleles at the locus after replication at the S phase. In other words, sister chromatids are exact copy of one another.

The correct option is D.

A 67-year-old was previously diagnosed with rheumatic heart disease. Tests now reveal lipoprotein deposition with chronic inflammation that impairs blood flow from the left ventricle into the aorta. Which diagnosis does this history support?

Answers

Answer:

Aortic stenosis

Explanation:

Aortic stenosis is one of the most common cardiovascular diseases. This disease is caused by the narrowing of the aortic valve opening, thereby restricting blood flow from the left ventricle to the aorta. Symptoms of aortic stenosis include, among others,  heart palpitations, swollen feet, chest pain, breathing difficulties, sleeping difficulties, chronic fatigue, etc. Aortic stenosis may be cured by transcatheter aortic valve replacement, which is a minimally invasive surgical technique that allows to replace the narrowed aortic valve.

how did the settlers view panther when they came to north America

Answers

Answer:

They viewed the Panther with fear and set out on a mission to exterminate it.

Explanation:

The first Spanish conquistador to ever sight a Panther was Alvar Nunez Cabeza de Vaca in 1513. When he saw the panther which he referred to as a lion, he was fearful of the animal. He and other Europeans set out on a mission to exterminate all Panthers. This was also necessary as they had to clear the bushes for them to reside.

In 1821 when Florida officially became a part of the United States, and people had to relocate there, a $5 dollar bounty was placed on every Panther killed. The Panthers relocated farther into the wild. As of 1990, the population of the Panther was just around 50. Panthers have since been named an endangered species.

Las Vegas Natural History Museum

Define Museum.

Answers

Answer:

A museum is a location that contains historical art and artifacts.

Explanation:

I need to break free

I WANT TO BREAK FREE!!!!!!!!!!!!!

Some especies are protected by law from being hunted because

Answers

Answer:

Explanation:

Some especies are protected by law from being hunted because if there not people would just keep on hunting them to extinction and also these kind of species are rare because people hunted alot of them

please mark brainly

Sasha is studying a rock formation for her science class. Every few days she goes outside to study the formation. The questions she is
investigating are shown.
• Did the rock freeze and
unfreeze?
• Are there any plants growing on
the rock?
• Did the rock change color?
What question is Sasha most likely trying to answer?
O A. What is the age of the rocks in the rock formation?
B. What type of rocks are found in the rock formation?
C What processes are weathering the rock formation?
D. What minerals are the hardest in the rock formation?

Answers

Answer:

ill say c

Explanation:

What effect with the enzymes have on the time to make 1 MG of product

Answers

Answer:

Decreases

Explanation:

Enzymes speed up chemical reactions so the product is made in less time

When does the Mitosis-promoting factor (MPF) Cyclin concentration decline during a typical cell cycle in clam eggs?

A. when the cells grow larger
B. when DNA is synthesized
C. when haploid gametes are produced
D. when the cell nucleus divides

Answers

Answer:

D

Explanation:

Answer:

D

When the cell nucleus divides

Explanation:

The two kinds of cells are Prokaryotes and Eukaryotes. How are they
different? *
O Prokaryotes have a nucleus.

OEukaryotes have a nucleus.

O Prokaryotes are plant cells

оThere is no difference.

Answers

Eukaryotes have nucleus and protaryotes have plant calls that’s the difference

An operon in E. coli called the Gua operon, encodes proteins responsible for guanine biosynthesis. Two genes, guaA and guaB are under the control of a single promoter and operator, similar to the arrangement in the lac and trp operons. A repressor protein, purR, binds to the operator. In what conditions (high guanine or low guanine) do you suppose this repressor binds to the operator? Do you consider this a "repressible" or "inducible" operon? 3 pts

Answers

Answer:

Hight guanine"Repressible" operon

Explanation:

An operon is a fragment of DNI with genes that encode for different proteins of metabolic vias. Operons are composed of a regulator gene (that codifies for the repressor), the operator region (that links with the repressor protein), and the promotor sequence (RNA polymerase recognizes the promotor where it begins the RNA synthesis).

The repressor deactivates the expression of a gene when binding the operator of that gene. This binding does not allow the production of mRNA, and hence, proteins that this molecule should synthesize.

This protein has a negative effect on genic expression impeding the transcription of RNA from DNA.

Operons might be inducible or repressible. When the operon is inactive, and a little inductor protein activates it, then the operon is inducible. On the contrary, the repressible operon is the one that is normally active, but the little corepressor protein inactivates it.

During high guanine concentration, the repressor protein must act to regulate the amount of guanine in the environment. Hence it links the operator of genes guaA and guaB to stop the biosynthesis. The operon was initially active, but then by the union of the repressor, it gets inactivated. This is a "repressible" operon.

List and describe the different types of connective tissue. What similarities and differences did you observe?

Answers

Answer:

There are three types of connective tissues, loose connective tissues, dense, and hyaline.

Explanation:

The difference between them is the composition of the extracellular matrix that surrounds the fibroblast, that is to say that in loose connective tissue, the function will be of support or filling, and the fibroblast is immersed in an extracellular matrix with a high content of water and proteins. collagen.

On the other hand, in dense connective tissue, the amount of collagen fibers is greater, the protein structure as well, and the interlacing between proteins is more complex, and they may also have the ability to calcify as in the case of bone tissue or cartilage.

Finally, we have the hyaline connective tissue, which is very rich in hyaluronic acid and is found in the joints forming the discs, which are shock absorbers and protectors from bone wear due to friction between surfaces, hyaluronic acid, proteinglycans and glycoproteins are the main protagonists of all connective tissues together with the fibroblast, but even more so in the hyaline connective.

Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?

Answers

Answer:

i’d say mitochondria

Explanation:

mitochondria is the “powerhouse of the cell”

One factor that determines the amount of oxygen transferred from the lungs to the blood is
the total functional surface area of the respiratory membrane.
O True
O False

Answers

Answer:

true

Explanation:

SOMEONE PLZ HELP!!!!!!!!!

Answers

Answer:

Organelle :)

Explanation:


What causes this change in fur color?

Answers

Hair dye does .jason doe doe did dows

Which are properties of metals? Check all that apply
Dullness
Malleability
Ductility
Poor conductors of heat
Good conductors of heat

Answers

Metals are malleable
Metals are ductile
Metals are good heat and electricity conductors
Metals lose electrons in reactions.

Answer:

2,3, and 5

Explanation:

got it right on edge

Carbon dioxide + Water + Sunlight -> Glucose + ?
Which of these is needed to complete this equation?
A Carbon
B Hydrogen
C Oxygen
D Nitrogen

Answers

Answer:

C. Oxygen

Explanation:

plant needed Carbon dioxide, water, and sunlight to produce Glucose and oxygen.

The answer is C. Oxygen

We find DNA on the ___, In every living cell that an organism owns
a. chromosomes
b. reproduction
c. mitosis

Answers

Answer:

A. Chromosomes

Explanation:

A Chromosome is some thing carrying genetic information in the form of genes.

We find DNA on the chromosomes, in every living cell that an organism owns. So, the correct option is A.

What is Chromosome?

The word chromosome comes from the Greek words for color (chroma) and body (soma). Chromosomes are so named because they are cell structures, or bodies, that are strongly stained by certain color dyes used in research.

Chromosomes are defined as structures found inside the nucleus of a cell that are organized into genes from proteins and DNA. Each cell normally has 23 pairs of chromosomes.

These are threadlike structures which are made of protein and a single molecule of DNA that serve to carry the genomic information from cell to cell.

Therefore, the correct option is A.

Learn more about Chromosomes, here:

https://brainly.com/question/10234301

#SPJ6

True or false?

An apple, potato, and onion all taste the same if you eat them with your nose plugged

Answers

Answer:

True

Explanation:

Answer:

True

Explanation:

It is frequently quoted that upwards of 80% of our taste is made up by smell. So if you plug your nose and cover your eyes, the taste between an apple and onion should be indistinguishable. Potato's will also taste the same .

SOMEONE PLZ HELP!!!!!!!!

Answers

A - Endoplasmic Reticulum.

What do the dotted lines, indicated with the arrow, represent in the DNA model above?

The junctions of codons between individual strands
The bond between deoxyribose molecules and phosphates
The monomers that make up a polymer
The hydrogen bond between complimentary nucleotides

Answers

Answer:

The hydrogen bond between complimentary nucleotides.

what makes stem cells different from cells in the body

Answers

Answer:

Stem cells are the body's raw materials

Explanation:

Stem cells are the body's raw materials — cells from which all other cells with specialized functions are generated. Under the right conditions in the body or a laboratory, stem cells divide to form more cells called daughter cells.

Stem cells are different from the other body cells as these are unspecialized cells which can undergo division and renew on their own. The stem cells can undergo specialization by the process of cellular differentiation.

What are Stem cells?

Stem cells can be defined as the body's raw materials. These are the cells from which all the other cells with specialized functions are generated.

Embryonic stem cells are the pluripotent stem cells derived from the inner cell mass of a blastocyst. Blastocyst is an early-stage pre-implantation embryo. Human embryos reach the blastocyst stage in 4 to 5 days post fertilization, at which time they consist of 50 to 150 cells.

Stem cells are different from the other cells in the body in three ways which are the stem cells can divide and renew themselves over a long time. Stem cells are unspecialized cells, so they cannot do specific functions in the body unless they undergo cellular differentiation. Stem cells have the potential to become specialized cells, such as muscle cells, blood cells, and brain cells by undergoing cellular differentiation.

Learn more about Stem cells here:

https://brainly.com/question/25584485

#SPJ2

Which of the following terms best describes the study of genes during the 1900s?
A. predictable
B. guarded
C. progressive
stagnant

Answers

The correct answer is C :)

SOMEONE PLZ HELP ME, PLZ I WILL MARK BRAINLIEST

Answers

Answer:

All living things are composed of cells.

Cells are the basic units of structure and function for living things.

All cells come from pre-existing cells. Also, organisms grow by “adding on more cells” NOT by increasing the size of their cells.

Explanation:

Clue 1:
a. DNA is made of nucleotides.
b. Protein is made of amino acids.
c. DNA is located exclusively in the nucleus.
d. Protein is synthesized exclusively in the cytoplasm.
1) What two problems does the transfer of information from DNA to protein need to overcome?
a.
b.

Answers

DNA is made of necleotides.
Other Questions
Emphasizing personal selling rather than mass media advertising is an example of a __________ strategy. Use FOIL to explain how to find the product of(a + b)(a b). Then describe a shortcut that you could use to get this product without using FOIL. What pricing strategy begins with an assessment of customer needs and perceptions and then a target price is set based on customer perceptions of worth? Please help me with my work Find BA CB + BA = CA 7x-2 + 5x+1 = 23 Item 1Order the numbers from least to greatest.3/4, 0.5, 2/3,7/3, 1.2 Normal or regular syntax follows which pattern? Group of answer choices: 1 beginning, middle, end 2 verb, subject, object 3 subject, verb, object 4 article, subject, verb Students haveminutes to complete the Aspire writing test.A. 30O B. 60O C. 20O D. 50 express cards functionalities ASAP PLS....I need this for tomorrow:( Find the missing measure and write your solution on the blank provided Three out of five people surveyed said that Shrek 2 is better than Shrek 3 and Shrek 4. If a total of 560 people are surveyed, how many would you expect to agree that Shrek 2 is better? Un paciente puede presentar inmunodeficiencias por mltiples causas, principalmente secundarias. Una de las siguientes es causa posible de inmunodeficiencia: Callan goes for a hike every Saturday. Callan hikes at a rate of 3 miles per hour.Complete the table for the given ratio. What is the impact of traditional dances in the Philippine culture and how can we enrich such dances? Find the area of a circle with a radius of 11 inches cecilia ha perdido sus gafas nuevas 7 types of motion you experience through the day. Please hurry!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Base your answer on the passage belowSmokers are passing down problems to future generations. Men who smoke and drink alcohol could be endangering the health of their future children and grandchildren. Toxic chemicals in cigarettes and alcohol are thought to cause changes in the DNA, which are passed down via the sperm to future generations.4.Explain how smoking and drinking alcohol by males can affect the development of an embryo. Complete the following sentences with the appropriate forms of the verb ir.1. Andrs y yo _ a comer en la cafetera hoy.2. Ellos _ a estudiar ahora, No?3. Adnde _ Juan?4. T _ Al supermercado.5. Mam y yo _ a llamar a abuelita.6. Ricardo _ a limpiar El cuarto.7. Yo _ a escuchar la radio.8. Ella _ a escribir una Carta.9. Ellas _ a comer en El restaurante Nuevo.10. Paco y yo _ a escuchar una cancin.Use va, vamos, voy, van, vas