Check Concepts
41. Using the scientific definition, which state-
ment is always true of work?
A) It is difficult.
B) It involves levers.
C) It involves a transfer of energy.
D) It is done with a machine.

Answers

Answer 1

Answer: C. It involves a transfer of energy.

Answer 2

Using the scientific definition, the statement that is always true of work is it involves a transfer of energy. The correct option is C.

What scientific theories?

Scientific theories are the theories that are given by scientific facts and information. These theories are based on observation of natural things and places.

There is the transfer of energy in the natural world. Every organism and plant is connected with each other in the form of a transfer of energy. This is called a food chain.

In the food chain, the organism is divided into different levels. These levels are based on their food. They are autotrophs, heterotrophs, and decomposers. Autotrophs have the largest amount of energy.

Thus, the correct option is C) It involves a transfer of energy.

To learn more about scientific theories, refer to the link:

https://brainly.com/question/2375277

#SPJ6


Related Questions

What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?

Answers

Hhhyyyyyggvvvvvvbhhhhhyyyyyggggghgggggffcvvvfffffffhz gzmysmydyysudkdjdisrw and the dttyyuuuuiiiiuuuuu

Explain how one celled organisms get oxygen in water.

Answers

Answer:

n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.

Explanation:

Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid

Answers

Answer:

Lipid is the most likely answer.

SOMEONE I NEED HELP!! I'M STUCK 30 POINTS!!!!!
PART A
An advantage of mitosis is the result of genetically____________.
A. Different
B.Identical

PART B
cells being reproduced
A. slowly
B. Quickly

Answers

I think A for part 1 and B for part 2 but not sure
Part A : Mitosis creates identical copies of the original cells.

Part B : That question is worded weirdly so I don’t understand that.

Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?

Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?

Answers

Answer:

Wedging (for the first one)

Explanation:

WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:

glycogen is to glucose.

testosterone is to a steroid hormone.

a phospholipid is to a plasma membrane.

a nucleotide is to a nucleic acid.

Answers

Answer would be D!
Mark brainliest

Transcription: DNA to mRNA: 1. How many strands of mRNA are transcribed from the two "unzipped" strands of DNA? 2. If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA code onto mRNA? G-G-A-T-C-G-C-C-T-T-A-G-A-A-T-C 3. If DNA Is described as a double helix, how should mRNA be described? 4. How are the accuracy of DNA and mRNA codes assured?
( help please)​

Answers

Answer:

what are u taking this on


What would be the temperature at a depth of 2500 km?


Answers

Answer:

4700 Degrees Celsius

Explanation:

ASAPPPP!!!!
Write step by step instructions for making a protein

Answers

Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. Transcription is the transfer of genetic instructions in DNA to mRNA in the nucleus. It includes three steps: initiation, elongation, and termination.

100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content

Answers

Answer:

B

Explanation:

YOOOOOOOOOOOOOOOOOOOOOO

ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

If you were to leave a pan of water outside for several days what would happen
Write a scientific report on the what would happen, and how would they relate to the tree states of water: solid, liquid and gas.

At least 3 paragraphs.​

Answers

Answer:

the water would evaporate and the water would be gone

Explanation:

hope this helps

hurry due in five min plz help

Answers

Answer:

b

Explanation:

Answer:

d

Explanation:

I hope that helped!

If researchers use only the number of coral found in dive 1, calculate the predicted population of brain coral in a reef that covers 120m squared. i forgot how to do this :))

Answers

Answer:

40

Explanation:

Each quadrant measured = 2m X 2m

Length = (2+2+2) m = 6m

Width = 2m

Total area = area of (quadrant 1 + quadrant 2 + quadrant 3)

Total area = 6 * 2 = 12 m^2

Number of coral found in dive 1 = 4

Population density = 4/12 = 1/3 (0.33)

Now,

=> Population density = (Predicted population)/area

=> 1/3 = PP/120

=> PP = 120/3 = 40

So, the required answer is 40.

The predicted population of brain coral in a reef covering 120m² is ; ≈ 40

First step : Calculate the value of the default population density

Population density = population size (dive 1) / total area

                                                                = 4 / 12  = 0.33

Total area ;

∑ Area of each reef quadrant = length * width = 2 * 2 = 4m²

∴ Total area = 4 + 4 + 4 = 12m².

Final step : Determine the value of the predicted population of brain coral

Population density = ( predicted population ) / predicted area

0.33 = ( pp ) / 120m²

Predicted population ( pp ) = 0.33 * 120

                                                 = 39.6 ≈ 40 brain corals

Hence we can conclude that the predicted population of brain coral is 40

Learn more : https://brainly.com/question/16495075

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

Please Help me as soon as possible.

In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.

Answers

Answer:

The answer is; c

It is important to distinguish between codominance and incomplete dominance.

In incomplete dominance, the two alleles blend with each other in phenotype  giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.

In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.

Explanation:

What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?

Answers

The proton gradient produced by proton pumping during the electron transport chain is used to synthesize ATP. Protons flow down their concentration gradient into the matrix through the membrane protein ATP synthase, causing it to spin (like a water wheel) and catalyze conversion of ADP to ATP.

........ produces hormones and enzymes that aid digestion.

Liver

Gall bladder

Pancreas

Urethra​

Answers

Answer:

urethra

Explanation:

Answer:

Pancreas and liver

Explanation:

In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion

Answers

Answer:

Facts that is right

Explanation:

In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.

These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.

Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

Learn more about:

https://brainly.com/question/7135096

Which name is best for my new bearded dragon?
1. Chili
2. Mushu (dragon from Mulan)
3. Blue (dino from Jurassic Park)

Answers

Mushu is a definitely answer

Answer:

Mushu

Explanation:

what is the percentage of thymine in wheat ?

Answers

Answer:

27.1% or 27% if rounded

Explanation:

Hope this helps ya!!

question one : when two plates converge, they are what?

a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other

question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other

question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age

Answers

Q1. They are d. colliding with each other.

Q2. They are c. sliding along each other (in a processes called “subduction”)

Q3. Rocks furthest away from the ridge are b. oldest the further away you move from the ridge. The youngest rocks can be found closest to the mid ocean ridge.

Give two examples each of centripetal force​

Answers

Answer:

Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.

Explanation:

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

A h e t e r o z y g o u s parent is crossed with a h o m o z y g o u s recessive parent. Complete a Punnett Square and answer the questions below.

Answers

I Am Not Sure What Your Asking?

Answer:

Black Fur & Black Eyes: 4/16

Black Fur & Red Eyes: 4/16

White Fur & Black Eyes: 4/16

White Fur & Red Eyes: 4/16

4 is 1/4 of 16

Explanation:

I hope this helps

The law of___________explains how traits are inherited through generations.

Answers

Answer:

the law of inheritance

Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae

Answers

Your answer is d he saw brown algae

Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.

What are brown algae?

Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.

Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.

Learn more about brown algae, here:

https://brainly.com/question/8717436

#SPJ2

Using the diagram below, how many electrons will Be have if it is a neutral atom?

Answers

the answer is six electrons

Which of the following is a pluton?
A. Pyroclast
O
B. D*ke (it's a type of rock not the slur)
O
C. Lahar
O
D. Lava flow​

Answers

Answer:

The correct answer is d*ke

Explanation:

I tried the other answer and got it wrong, this was the right one on the test.

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

4) How does climate affect ecosystems and the life within them?

Answers

Answer:

Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.

Other Questions
COULD SOMEONE HELP ME ITS URGENT!!!!Omar flies his plane out of a local airport. The airport is at an altitude of 1100 feet above sea level. He flies his plane to an altitude of 2500 feet above sea level. Which number represents sea level? Refer to Mesmerized: How Ben Franklin Solved a Mystery that Baffled All of France for a complete version of this text. Part A Why do French doctors dislike Dr. Mesmer? O Mesmer is better at curing their patients than they are. Mesmer has tricked their patients into believing in fake treatments. O He has taken all of the king's attention and favor. O He has become extremely popular among the wealthy. Part B solve (2x-10)=(65-x) Confucius lived during which dynasty? help pleaeeeeesssssssss Which situation would most likely result in a country forming a large nationaldebt?A. A government cuts spending every year on key programs likehealth care.B. A government raises taxes every year on its most profitablecompanies.C. A government borrows money every year to make up for its budgetdeficits.O D. A government is required to submit a budget every year thatcreates a surplus. [EASY + BRAINLIEST] Find the slope-intercept equation of the line. PLEASE HELP! questions.What are the bases of foreign relation of Nepal? Taylor, Inc., stock has a beta of 1.2 and an expected return of 9.3%. The risk-free rate is 4.1% and the market risk premium is 6.8%. This stock is _____ because the CAPM return for the stock is _____%.a. overvalued; 11.87.b. undervalued; 12.09.c. undervalued; 12.26.d. overvalued; 12.26.e. undervalued; 11.87. Solve this system using elimination (20 POINTS)4x-7y=3x-7y=-15 The time constant for RC circuit with the values of R1 and C1 is 5ms. What will be the time constant for a new RC circuit with the values: R2=10R1 and C2 = 0.5C1.a. 2.5ms b. 15.5ms c. 50ms d. 25ms e. 15ms Someone please help will mark as brainliest What is the equation of the line that passes through the points (3,6) and (-4,-8) Which set of transformations is needed to graph f(x) = -0.1cos(x) - 4 from the parent cosine function?reflection across the y-axis, vertical compression by a factor of 0.1, vertical translation 4 units upreflection across the x-axis, vertical compression by a factor of 0.1, vertical translation 4 units downvertical stretching by a factor of 0.1, vertical translation 4 units down, reflection across the y-axisvertical stretching by a factor of 0.1, vertical translation 4 units up, reflection across the x-axis Mr. Rankin took his family out to dinner last night and their subtotal was $88.24. The sales tax was 5% and he left a 20% tip after the tax was added. The width of a rectangle is 2 cm less than its length. The perimeter of the rectangle is 16 cm. What are the dimensions of the rectangle? The president can veto bills from Congress. Which arrow on the diagram stands for this checkon legislative power?Which arrow on the diagram stands for this check on legislative 8x+5x= 1300what is x -how do photographs convey meaning? How do viewers contribute to constructing that meaning? (6th grade math)68.2x8.4=?