How many forms do all Spanish verbs have? i.e. when you conjugate a verb, how many different conjugations are there per verb?

four

five

six

two

Answers

Answer 1

Answer:

six

Explanation:

The reason there are six conjugations is because of the 3 people and then the 2 options for singular or plural, so if you multiply 3x2=6

Answer 2
The answer would be six

Related Questions

Tell which pronoun (Yo, Tú, Él, Ella, Ud., Nosotros, Nosotras, Ellos, Ellas, Uds.) would replace the underlined subject of each sentence.



Juan y Marta<--- (underlined) van a la clase de historia.

Answers

Answer:

Ellos

Explanation:

“Nosotros”

Explanation: It’s saying”Martha and Juan ____ are going to history class ” so in English it would be “we are” which in Spanish translates to nosotros

Find A Word From The Passage which mean the same as sell​

Answers

we need the passage or answers

Answer:

where's the passage?

Explanation:

helpppp what goes in the blanks and pls answer seriously omggg

Answers

1- están
2-está
3-estáis
4-está
5-están
6-estamos
7-está
8-estoy

Answer:

1. Están

2. Está

3. Estáis

4. Está

5. Están

6. Estamos

7. Está

8. Estoy

Explanation:

5 pounds of apples cost $12. At this price, how much do 3 pounds of apple cost? Show your work using proportion or ratio table.

Answers

What does this have to do with Spanish?

Perú gained its independence from Spain.
In
a.
b
1530
1495
C. 1821
d. 1681
Please select the best answer from the choices provided

Answers

The answer is C. 1821
The answer is C. July 28, 1821.

What is the ideal weather for these activities?
1. skiing
2. going to the beach
3. going sailing
4. watching tv
5. drinking hot chocolate
6. taking a walk

Answers

Answer:

Explanation:

1. Winter

2. Summer

3.  Summer

4. Anytime

5. Winter or Fall

6. Spring or Summer

1.cold
2.hot
3.hot
4.Doesnt matter
5.cold
6. you can take a walk anytime but i think people prefer in the hot or warmish weather

Complete the sentence using the correct form of the verb estar.
(1 point per question)
1. Mi hermano[. ]
contento.
2. Yo[. ]
bien.
3. Nosotros[. ]
mal.
4. El bebé[. ]
triste,
5. Usted[. ]
enojado
6. Los chicos[. ]
preocupados,
7. Mis abuelos[. ]
nerviosos.
8. Su hermana[. ]
cansada.
9. Ustedes[. ]
enfermos
10. Ellas[. ]
enojadas.
11. El niño[. ]
mal.
12. Tú[. ]
bien.

Answers


1. Mi hermano[esta]
contento.
2. Yo[estoy]
bien.
3. Nosotros[estamos]
mal.
4. El bebé[esta]
triste,
5. Usted[estan]
enojado
6. Los chicos[estan]
preocupados,
7. Mis abuelos[estan]
nerviosos.
8. Su hermana[esta]
cansada.
9. Ustedes[estan]
enfermos
10. Ellas[esta]
enojadas.
11. El niño[esta]
mal.
12. Tú[estas]
bien.
Mi hermano ESTÁ contento

Yo ESTOY bien

Nosotros ESTAMOS mal

El bebé ESTÁ triste

Usted ESTÁ enojado

Los chicos ESTÁN preocupados

Mis abuelos ESTÁN nerviosos

Su hermana ESTÁ cansada

Ustedes ESTÁN enfermos

Ellas ESTÁN enojadas

El Niño ESTÁ mal

Tu ESTÁS bien

Which of the following jobs would be the best fit for Marco based on his abilities and interests as described in his e-mail? A.profesor de espãnol. B.programador de computadoras. C. Matemático D.profesor de biología

Answers

Answer:B

Explanation:

help me please!!!!i dont know the answer​

Answers

it really depends which way you’re saying it
It depends but if I’m using it correctly it’s ustedes

Choose the correct completion for each sentence.
Al llegar al hotel el cliente va primero ____
a su cuarto
a la recepción
al ascensor

Answers

I believe it’s “a la recepción” because when you walk into an hotel,you first go into the reception desk

Choose the best conjugation of IR to tell who is going where this morning.

Sus amigos _____ a un museo.

voy
vamos
van
va

Answers

van because the other answers are incorrect

Answer:

C). van

Explanation:

Qué tiempo duro la primera entrevista por televisión?

Answers

How long did the first interview last?

Practice exercises: Write the correct Spanish subject pronoun for each subject. Modelo: Miguel y yo ____nosotros_____
1. Ana y María _________________________
2. Tú y tú _________________________
3. Tú y José _________________________
4. Tú y yo _________________________
5. Ustedes y el profesor _________________________
6. Mi amiga y yo _________________________
7. Tú y ella _________________________
8. Marcos _________________________
9. Manuel y Andrés _________________________
10. Susana _________________________

Answers

Ana maria y yo
Tu y tu y nosotros
Tu y jose y yo
Tu y yo y nosotros
Ustedes y el profesor y yo
Mi amiga y yo y nosotros
Tu y ella y yo
Marcos y yo
Manuel y andres y yo
Susana y yo

Answer:

1. Ana y María ________ellas_________________

2. Tú y tú ________Ustedes_________________

3. Tú y José _______Ustedes__________________

4. Tú y yo _________nosotros________________

5. Ustedes y el profesor _______Ustedes__________________

6. Mi amiga y yo _________nosotras________________

7. Tú y ella _________ustedes________________

8. Marcos ________él_________________

9. Manuel y Andrés ________ellos_________________

10. Susana ________ella_________________

Cómo dice el poeta que serán muchos los que irán al otro lado

Answers

It means - how the poet says that there will be many who will go to the other side

free poisnts
elizabetharnold84 answer only

Answers

can i also answer thanks for the points lol

Thank you, pal!

:)

yay

Model:
Mi familia y yo somos de Ohio. Nosotros
somos americanos.
1. Michael Jordan es muy alto.
es atlético
2. Mi maestra es la Sra. Taylor.
es de Ohio.
3. Juan y Berto son de Ohio y Michigan.
son compañeros de clase.
4. Mi papá es muy fuerte.
hace mucho ejercicio.
5. Las muchachas son bonitas.
son mexicanas.
6. Samuel y Noé, ¿de dónde son
?
7. Ana, ¿cómo estás
hoy?
8. La Sra. García y la Sra. Alvarado son maestras.
son inteligentes.
9. Mis amigos y yo somos estudiantes.
somos compañeros.
10. Mi mamá se llama Julie.
es muy alta y bonita.
11. Mi perro se llama Maverick.
es grande y negro.
12. Sr. Garcia, ¿de dónde es
?

Answers

They aren’t helping Humberto find out the rest of Ohio wich they are trying to get to so the answer would be C!

Ordenar Escucha la narración y ordera las oraciones de acuerdo con los
eventos de la vida de Beatre.
a. Banz se compromete
con Roberto
b. Beatru se gradúa.
-
d. Sus padres le hacen
una gran fiesta.
e. La pareja se casa.
f. Beatriz nace cu
con Emilia

Answers

Answer:Order Listen to the narration and order the sentences according to the

events in Beatre's life.

to. Banz commits

with Roberto

b. Beatru graduates.

-

d. His parents make him

A big party.

and. The couple is getting married.

F. Beatriz was born cu

with Emilia

Explanation:


When translating the following sentence into Spanish, fill in the missing word/ words:
"She is a girl" - Ella (blank) (blank) chica.

Answers

Answer: Ella es una chica/niña.

Ella es una ninã for the answer to the problem

Un dia en el futuro, mis amigos y yo

saldrémos a recoger basura.
saldremos a recoger basura.
saliamos a recoger basura.

Answers

Answer:

the second choice!

Explanation:

Answer: Saldremos a recoger basura

Explanation:

¿Cómo ha evolucionado la comunicación en el paso del tiempo?

Answers

Answer: En el pasado no teníamos tecnología. Hoy en día tenemos tecnología todo es rápido

Explanation: ¡Espero que mi respuesta te haya ayudado! Por favor, marque mi respuesta Brainliest y ¡Gracias!

Answer:

Ahor a no se usan casi radios para esuchar las noticias o otras cosas,  ahora con la internet se hacen cosas mas rapidas

Explanation

Maria es de Perú. Ella es
O peruano
O peruanas
O peruanos
O peruana

Answers

Maria es de Perú así que Ella es peruana
The answer is Peruana!

Choose the correct Preterite conjugation.
Mi madre
(cocinar) la cena anoche.

Answers

Answer:

Cocinó.

Explanation:

Mi madre  cocinó la cena anoche.

The correct conjugation in Preterite Tense of the verb between parentheses is:

cocinóMi madre cocinó la cena anoche.

Preterite Tense in Spanish.

The conjugation of the verb "cocinar" in preterite tense, taking into account the personal pronouns is:

Yo: cocinéTú: cocinasteUsted: cocinóÉl: cocinóElla: cocinóEllo: cocinóNosotros / Nosotras: cocinamosUstedes: cocinaronEllos / Ellas: cocinaron

Since the sentence uses as a noun "mi madre," which can be replaced by the personal pronoun "ella," the appropriate conjugation based on the guide above is "cocinó."

More information:

https://brainly.com/question/12957016

Autoevaluación final
A.
1. La pequeña nina, aunque triste, leyó dulcemente,
2. Ella sonrie ante sus amigos.
3. Ellos observaban desde lejos su actuación
4. Juan y Carlos aplaudian estusiasmadamente.
5. Ellos eran sus fieles amigos.
6. El papa, orgulloso de ella, esperaba calmadamente,
7 Smyncro la valentía, pero nuestro el orgullo

Answers

Answer:

No

Explanation:

Escoge la mejor opción que completa la frase con la forma correcta del verbo bastar. Choose the best option to complete the sentence with the correct form of the verb bastar.

Puedo sugerir la paella valenciana, señores; es un plato grande y ________ para dos personas.

le basta
les basta
le bastan
les bastan

Answers

I think it is le bastan
Number 3 aka C aka le bastan

Miguel ____ a la iglesia.

1va
2vas
3van
4 voy

Answers

It is va, hope this helped
4 is for yourself
1 is in the tu form
2 and 3 I believe is for they
So I think it’s va

state the laws of vibrating string ​

Answers

Answer:

The fundamental frequency of vibrations of a stretched string is inversely proportional to its vibrating length if the tension and mass per unit length are kept constant.

It it, "Los deportistas se entrena en el gimnasio", or "Los deportistas quieren enrenarse en el gimnasio"?

Answers

It’s the second one

Read the sentence and choose the option with the correct amount in the sentence.

El inmueble cuesta setecientos mil quinientos veinte dólares.

600.330
600.520
700.520
700.330

Answers

700.520, the third option

Answer:

700.520 is the answer

Explanation:

it says that

¿Le
(decir) tú la información? Sí, yo le
(decir) todo.

Answers

should be: dijiste; dije

2. El SUPO todo anoche/ nosotros no SABEMOS nada

3. Ud PONE el libro en la mesa/ y ellos PONEN el libro en la bolsa

4. Yo QUERÍA estudiar ayer/ pero uds QUERÍA jugar

please help i will marke you brainiest

look below

Answers

Answer: "Tu" is the singular pronoun. i dont know the plural one.

Tu in English means you
Other Questions
Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False