If any number in decimal numeration system is denoted by 723 then what is the value of the number in binary numeration system?​

Answers

Answer 1

Answer:

723 -> 01011010011

Step-by-step explanation:

If Any Number In Decimal Numeration System Is Denoted By 723 Then What Is The Value Of The Number In

Related Questions

Which inequality is shown in this graph?
(-2, 2.
• (0-2)
A. Y=2x-2
OOC
B. y 2 - 2x - 2
c. y = 2x - 2
D.VS - 2x - 2

Answers

the slope is negative and the y-intercept is -2 so the line should be -2x-2, and the space is under the line so the answer is D

what is the value of x

Answers

Answer:

I Know the answer but it has too many steps-by-step explanation so I cant tell comment and mark me brainliest.

Step-by-step explanation:

The next two systems do NOT have opposite like terms ​

Answers

Answer:

x = 10

y = 6

Step-by-step explanation:

Multiply second equation with -1 and then add it up with first equation

(-1)*(6x - 7y) = 18

-6x + 7y = -18

6x - 6y - 6x + 7y = 24 - 18 add like terms

y = 6 to find the value of x use this information

6x - 6y = 24 replace y with 6

6x - 6*6 = 24

6x - 36 = 24 add 36 to both sides

6x = 60 divide both sides by 6

x = 10

The formula below represents the standard form of a quadratic equation,
ax2 + b + c = 0
Solve for b.

Answers

Answer:

[tex]b=-a^2-c[/tex]

Step-by-step explanation:

A shirt costing $34 is on sale for 30% off. What is the new price of the shirt after the discount?

Answers

Answer:

$23.80

Step-by-step explanation:

30% off means we take 30% off of the original price, or we calculate

(1-30%)=70% of the shirt's price

34*70%=23.8

2x-3y=7 and y=3x-7 how do you solve this using subsitution

Answers

[tex]2x-3y = 7~~~....(i)\\\\y = 3x -7~~~....(ii)\\\\\\\text{Substitute}~ y = 3x -7~ \text{in equation (i):}\\\\\\2x-3(3x-7) = 7\\\\\implies 2x -9x + 21 =7\\\\\implies -7x = 7 -21\\\\\implies -7x = -14\\\\\implies x = \dfrac{-14}{-7} = 2\\\\\\\text{Substitute x = 2 in equation (ii):}\\\\y=3(2) -7 = 6 -7 = -1\\\\\\\text{Hence (x,y) =(2,-1)}[/tex]

Need help pls answer asap. Sorry the photo quality is bad.

Answers

Answer:

Step-by-step explanation:

1 + 3 = 4

so find the point 1/4 of the way from (-1, 2) to (7, 8)

x coordinate

Δx = ¼(7 - (-1)) = 2

x = x₀ + Δx

x = -1 + 2 = 1

y coordinate

Δy =  ¼(8 - 2) = 1½

y = y₀ + Δy

y = 2 + 1½ = 3½

(1, 3½)

GIVING 25 POINTS
Why won’t you ever have a remainder when dividing decimals?

Answers

Answer:

Because it is decimal

Step-by-step explanation:

Decimal do not have remainder

Graph all solutions on a number line and provide the corresponding interval notation. 1. 3x + 5>-4 2. 2x+1> -1 3.5-6y < -1 4.7-9y> 43 5.6-a≤6​

Answers

Graphs attached

Done!

Hopw it helps

If A is the center of the circle which of these is the radii

Answers

Answer:

A-b because radius is the line segments from its center to its perimeter

Step-by-step explanation:

1 less then the quotent of a number n and 6

Answers

" the quotient " means divide

(n/6) - 1 <== ur expression

according to Ms. Duckett, what is important to remember about finances?

Answers

Answer:

Being financially literate helps a person to distinguish between financial decisions that will be beneficial, and that will be detrimental to their financial future. Having a plan for your finances will help you meet your short and long-term needs, without going beyond your income

Step-by-step explanation:

Ppbags where here

The cost C in dollars of producing a certain item is represented by the equation C = n/2+ 20. where n
represents the number of items produced. The revenue R, in dollars, from selling n items is represented by
the equation R=2n+ 5. For what value of n are the cost and revenue equal?
O 5
O 10
O 15
0 20

Answers

The answer is B 10 don’t forget

Considering the definition of equation, for a value of n of 10 the cost and revenue are equal.

What is equation

A first degree equation is a mathematical equality with one or more unknowns.

Solving an equation consists of finding the value that the unknown must take so that equality is fulfilled.

The steps to solve an equation are as follows:

Group similar terms. That is, proceed to pass the terms containing variables from one side of the expression and the constants from the other side of the expression.Finally, the unknown is solved.

Value of n

The cost C in dollars of producing a certain item is represented by the equation C = [tex]\frac{n}{2}[/tex]+ 20, where n represents the number of items produced.

The revenue R, in dollars, from selling n items is represented by the equation R=2n+ 5.

The cost and revenue are equal. Then:

[tex]\frac{n}{2}[/tex]+ 20= 2n+ 5

Solving:

When a term passes to the other side of equality, its sign changes (if it is positive it becomes negative and vice versa):

20 -5= 2n - [tex]\frac{n}{2}[/tex]

15= [tex]\frac{3}{2}n[/tex]

The X is cleared. Since the term in front of it is multiplying, it goes to the other side of the equation by dividing.

15 ÷[tex]\frac{3}{2}[/tex]= n

10= n

Finally, for a value of n of 10 the cost and revenue are equal.

Learn more with this similar problems:

https://brainly.com/question/16905064

https://brainly.com/question/22375191

#SPJ2

#3) They say they have 50 total coins together made up of dimes and quarters. They also say that they have $7.25 total. How many quarters do they have?
A. 10
B.15.
C.20.
D.25​

Answers

Answer:

B: 15 quarters

Step-by-step explanation:

Step 1: Setup Coin Value and Coin Total Equation:

Coin Value Equation → 0.1d + 0.25q = $7.25 where d = dimes and q = quarters

Coin Total Equation → d + q = 50

Step 2: Rearrange Coin Total Equation in terms of dimes (d)

d = 50 - q ← Revised Coin Total Equation

Step 3: Plug in our Revised Coin Total Equation for d into our Coin Value Equation:

0.1(50 - q) + 0.25q = $7.25

0.1(50) - 0.1(q) + 0.25q = $7.25

5 - 0.1q + 0.25q = $7.25

5 + (0.25 - 0.1)q = $7.25

5 + 0.15q = $7.25

Step 4: Subtract 5 from each side of the equation to isolate q

5 - 5 + 0.15q = $7.25 - 5

0.15q = 2.25

Step 5: Divide each side of the equation by 0.15 to isolate q

0.15q

0.15

=

2.25

0.15

q = 15

Step 6: Using our value for q, Solve for d using our Coin Total Equation:

d + 15 = 50

Subtracting 15 from both sides, we get d + 15 - 15 = 50 - 15

d = 35

Summarizing our word problem, we see that 15 quarters and 35 dimes adds up to $7.25

special right triangles, solve for x, y and z

Answers

Answer:

x=14

y=27

z=43

Step-by-step explanation:

hope it helps!

A Biology test has 20 questions and is worth a total of 100 points. The test
consists of True/False questions worth 2 points each and multiple choice questions
worth 7 points each. How many of the test questions are multiple choice and how
many of the test questions are True/ False?.
# of true/false questions =
# of multiple choice questions
PLEASE HELP ME I WILL GIVE BRAINLY

Answers

Answer:

12 multiple choice and 8 True/False

Step-by-step explanation:

To do this we set up a system of equations. Let x represent the True/Fale questions and y represent the multiple-choice questions. Here is a system we can use:

x + y = 20

2x + 7y = 100

We can solve this by using elimination. To do this we multiply one equation by a number, and add them together. If we multiply the first equation by -2, the "x"s will, when added together, cancel out so we can solve for y.

-2(x + y = 20)

-2x - 2y = -40

Now add them together

5y = 60

Solve for y.

y = 12

This means there are 12 multiple choice questions. 20 - 12 is 8 True/False questions.

Hope this helps and have a great day! :D

Answer:

8 True/False and 12 Multiple Choice

Step-by-step explanation:

x+y=20  ...1

2x+7y=100   ...2

Now you can multiply 2 on 1

2x+2y=40

2x+7y=100

Subtract:

-5y=-60

Divide -5 on both sides:

y=12

Substitute y with 12

x+12=20

Subtract 12 on both sides:

x=8

So there are 8 True/False and 12 Multiple Choice

Hope this Helps!

Answer helped by: azailiaskoglund

The question in the picture​

Answers

Answer:

[tex]3^{30}[/tex]

Step-by-step explanation:

      When you are raising an exponent to another power, you multiply the exponents together:

[tex]3^{30}[/tex]

-> Hopefully this is correct, unfortunately the picture is quite blurry

Have a nice day!

     I hope this is what you are looking for, but if not - comment! I will edit and update my answer accordingly. (ノ^∇^)

- Heather

simplify (√(π -√17)^2)

Answers

Answer: The answer is Iπ + √17|.

3. My divisor is 8.
I am less than 30.
I am greater than 3 X 8.
My remainder is 5.
What dividend am I?

Answers

Answer: 29

Step-by-step explanation:

29 ÷ 8 = 3 remainder: 5

I solved using long division.

Answer:

29

Step-by-step explanation:

30

24

5

8x3=24

24+5= 29

Beacuase it had to be smaller than 30

what is 35 divided by 97.3

Answers

Answer: 2.78

Step-by-step explanation:

long division

Kevin and Randy Muise have a jar containing 80 ​coins, all of which are either quarters or nickels. The total value of the coins in the jar is ​$11.80. How many of each type of coin do they​ have?

Answers

Answer:

39 quarters and 41 nickels

Step-by-step explanation:

Let the number of quarters be x and nickels be y.

Given:

Quarter is 25 centsNickel is 5 centsNumber of coins is 80Total amount is $11.80 = 1180 cents

We have equations:

x + y = 8025x + 5y = 1180

Solve the system by elimination, subtract 5 times the first equation from the second one:

25x + 5y - 5x - 5y = 1180 - 80*520x = 780x = 780/20x = 39

Find the value of y:

39 + y = 80y = 80 - 39y = 41

Verify:

25*39 + 5*41 = 975 + 205 = 1180

What is is b? 2-b/3 =-5/2

Please explain thoroughly

Answers

Answer:

I'm not sure you mean 2-(b/3) = -5/2 or (2-b)/3 = -5/2

Step-by-step explanation:

if

2-(b/3) = -5/2

12-2b = -15

12+15 = 2b

27 = 2b

27/2 = b

else

(2-b)/3 = -5/2

2(2-b) = -5×3

4-2b = -15

4+15 = 2b

19 = 2b

19/2 = b

Graph the solution to the system
-x+y>2
X+2y>2

Answers

Answer:

[tex]\begin{bmatrix}y>2+x\\ y>\frac{2-x}{2}\end{bmatrix}[/tex]

Step-by-step explanation:

Step 1: Solve the system of equations

[tex]\begin{bmatrix}-x+y>2\\ x+2y>2\end{bmatrix}[/tex]

Isolate [tex]y[/tex] for [tex]-x+y>2[/tex]

[tex]\mathrm{Add\:}x\mathrm{\:to\:both\:sides}[/tex]

[tex]-x+y+x>2+x[/tex]

[tex]y>2+x[/tex]

Isolate [tex]y[/tex] for [tex]x+2y>2[/tex]

[tex]\mathrm{Subtract\:}x\mathrm{\:from\:both\:sides}[/tex]

[tex]2y>2-x[/tex]

[tex]\mathrm{Divide\:both\:sides\:by\:}2[/tex]

[tex]\frac{2y}{2}>\frac{2}{2}-\frac{x}{2}[/tex]

[tex]y>\frac{2-x}{2}[/tex]

[tex]\bold{=\begin{bmatrix}y>2+x\\ y>\frac{2-x}{2}\end{bmatrix}}[/tex]

Step 2: Graph

Instructions for graphing:

[tex]\mathrm{1.\:Graph\:each\:inequality\:separately.}[/tex]

[tex]\mathrm{2.\:Choose\:a\:test\:point\:to\:determine\:which\:side\:of\:the\:line\:needs\:to\:be\:shaded.}[/tex]

[tex]3. \mathrm{The\:solution\:to\:the\:system\:will\:be\:the\:area\:where\:the\:shadings\:}\\\mathrm{from\:each\:inequality\:overlap\:one\:another.}[/tex]

When done, it should look like this:

the cost of a popsicle at the snack stand is $0.75 let p represent the number of popsicles and c represent total cost use an equation to represent the relationship between the numbers of popsicles bought and the total cost

Answers

Answer:

0.75p=c

Step-by-step explanation:

Please answer. I will give brainliest to the best answer

Answers

Answer:

b

Step-by-step explanation:

took the test a bit ago

There are 11 students in a high school senior class. In how many ways could the yearbook choose the winners of Most Athletic, Class Clown, Best School Spirit, and Best Looking?​

Answers

We have 11 items and 4 choices

Using the formula for 11C4

We can work out that the amount of ways to choose 4 things from 11 is equal to

11!/(7!)(4!) = 330 ways

The number of ways the yearbook chooses the winners of Most Athletic, Class Clown, Best School Spirit, and Best Looking is 330 ways.

What are permutation and combination?

Combination and permutation are two different ways of grouping elements of a set into subsets in mathematics. The elements of the subset can be listed in any order in a combination. The elements of the subset are listed in a specific order in a permutation.

Given that there are 11 students in a high school senior class. The number of ways will be calculated as,

The formula for arrangement,

¹¹C₄ = 11!/(7!)(4!)

¹¹C₄ = 330 ways

To know more about permutation and combination follow

https://brainly.com/question/4658834

#SPJ2

3.
Mark is m years old. June is 6 years older that Mark. What is their total
age in 10 years' time?

Answers

Answer:

20m+60

Step-by-step explanation:

given,

mark=m

june=m+6(6 years older that mark)

so,

after 10 years,

10(m+(m+6)

=10(2m+6)

=20m+60

)) The volume of a pyramid with base area B and height his Bh. Jill makes candles
shaped like pyramids to sell at a craft fair. The candles are 6 inches tall and have a base area
of 4 square inches.
1) What is the volume of one of the candles?
1) Write your answer as a whole number or decimal.
cubic inches
Submit

Answers

Answer:easy it’s 8

Step-by-step explanation:I just did that same ixl/quiz!

what is 70*77 please help

Answers

Answer: 5390
70*7=5390
Here is why: The result of multiplying 70 with 77 is called the product. Thus, the product of 70 and 77 is as follows:

5390

In other words, we find the product of 70 and 77 by simply calculating 70 times 77 which equals 5390. Pretty easy huh?

If someone asks you, "What is the product of 70 and 77?", your answer will be:

70 x 77 = 5390

To find any product in the future on your own, just remember that the product is the answer you get when you multiply numbers together.

find the quotient 3^1^5/3^3 3^5 3^18 3^12 3^45

Answers

Answer:

It's about drive its about power put in the work put in the hours and take what's ours

Step-by-step explanation:

It's about drive its about power put in the work put in the hours and take what's ours It's about drive its about power put in the work put in the hours and take what's ours It's about drive its about power put in the work put in the hours and take what's ours It's about drive its about power put in the work put in the hours and take what's ours It's about drive its about power put in the work put in the hours and take what's ours

Other Questions
Which of the following goals is NOT a focus of typical community health promotion efforts? A. Lower prescription costs B. Long-term health C. Disease prevention D. Senior citizen health Please select the best answer from the choices provided. A B C D. Lyssa and Carlos own a hardware store. They sell a certain type of light bulb in packages that each contain 24 bulbs. The back of each package says, " The expected number of broken or defective packages per bulb is 0.25" Lyssa says, "If we look at 100 packages, we expect to see a total of about 250 broken or defectve bulbs" Carlos says, "Any given package most likely contains 0.25 broken or defective bulbs".Which Statement is correct based on the expected value?A. Only LyssaB. Only CarlosC. Both Statements are correct. D. Neither Statement is correct. Marko is playing the video game fort attack. The purpose of the game is to shoot invading bandits that are trying to breach the fort's circular wall, and marko must provide the angle at which the cannon should turn in order to shoot the attacking bandits. The bandit is attacking as pictured in the figure below:. Who is Francois Mauriac and why, according to the Preface/Foreword, does he help Wieselget published? How does Mauriac describe Wiesel? Use textual evidence to support youranswer:I a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72