Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer 1

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer 2

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n


Related Questions

2. What characteristics of bougainvilla plant makes animals to be afraid? A. It has spores on its stem C. It has thorns on its stem B. It has spreading, feathery root stem D. It has light rounded waxy leaves
PLEASE HELP ME I REALLY NEED THE CORRECT ANSWER RIGHT NOW!!!!​

Answers

Answer:

It has thorns on its stem

Explanation:

List the angles in order from smallest to largest. Note image in not drawn to scale

Answers

Using sine rule and cosine rule, the angles from smallest to largest is A,B,C.

Using the cosine rule;

a^2 = b^2 + c^2 - 2bc cos A

When;

a = 9 cm

b = 16 cm

c = 18 cm

9^2 = 16^2 + 18^2 - (2 × 16 × 18) cos A

81 = 256 + 324 - (576) cos A

81 = 580 - 576 cos A

81 - 580 = - 576 cos A

cos A = (81 - 580)/  - 576

A = cos-1[(81 - 580)/  - 576]

A = 30°

Using the sine rule;

a/sin A = b/sinB

asinB = bsinA

sinB = bsinA/a

B = sin-1(bsinA/a)

B = sin-1[(16 × sin30)/9]

B = 63°

Now;

A + B + C = 180(Sum of angles in a triangle)

C = 180 - ( A + B)

C = 180 - ( 30 + 63)

C = 87°

The angles are A, B, C.

Learn more about cosine rule: https://brainly.com/question/3240813

Which of the following does NOT happen during the light-dependent reactions of
photosynthesis?
ATP is produced
Oxygen is produced
Glucose is produced
NADPH is produced

Answers

Answer:

Glucose

Explanation:

Only glucose is produced in the light independent stage of the reaction

When a person senses a stimulus, the information is sent to multiple parts of the brain for processing and then on to a motor neutron for a response resulting in a voluntary response is known as ?

Answers

Fight or flight I think

What 4 things can affect the way enzymes work? Explain how each thing affects an enzyme

Answers

Answer

temperature, ph, concentration and enzyme substrate

Explanation

Enzymes work best within specific temperature and pH ranges, and sub-optimal conditions can cause an enzyme to lose its ability to bind to a substrate. Changing the pH outside of this range will slow enzyme activity.

Enzymes will work best if there is plenty of substrate

Why is it necessary for there to be variation in population in order for evolution by natural selection to occur?

Answers

Answer:

There needs to be variations in population in order for natural selection to occur because the entire point of evolution by natural selection is only the best variations will survive. So if there were no variations then there would be no natural selection because the animal's survival rate would be the same no matter how many times they reproduce because there are no different variations being introduced into the species. However, if there are variations then the animal's survival rate could be impacted because of the variations, for example, white mice would be easier to find for predators on a dark surface, while a darker mice would be harder to find for predators on a dark surface, thus, allowing the darker mice to prevail as they have a higher survival rate and the species will slowly evolve into the darker mice. But, if there were no evolution, in this case, then no matter what happens, the white mice would not be able to evolve into a darker mice because there are no such thing as variation. That is why it is necessary for there to be variation in order for evolution by natural selection to occur.

Which plate does not appear in both hemispheres?

Indo-Australian
African
Pacific
Eurasian

Answers

Answer:

Indo-Australian

Explanation:

Indo Australian plate because only located in the northern hemisphere

Most binary ionic compounds are also called metals.
A. True
B. False

Answers

B. It is false. hope this helps mark me brainlist

- Lysogenic life cycle of viruses causes the burst of the host cell (T/F)


- Spot method of detection of bacteriophages is a qualitative method
(T/F)

Answers

1. True. Both lysogenic and lytic cycle cause the host cell to burst and release new viruses. The difference is the lysogenic cycle has the viral dna insert into the host dna then a period of dormancy before creating viral proteins. 2.true. The spot test method can be used to give you a yes or no (positive or negative) to the presence of bacteriophages but it does not tell you a quantity so it is qualitative information.

Which feature forms at Earth’s surface from the cooling of lava?

extrusion
fault
intrusion
unconformity

Answers

Answer:

The correct answer is Extrusion.

Explanation:

I can confirm that it is 100% correct.

Answer: A

Explanation:

i took the test

is the chemical reaction below A. Kinase B. mutase C. dehydrogenase D. isomerase E. none of the above

Answers

Answer:

e

Explanation:

e

Which type of cell-to-cell junction joins intermediate filaments ( keratins) in one cell to the basal laminate; welding down the cells of the epithelial and providing tensile strength?
A. Right junction
B. Desmosomes
C. Gap junction
D. Hemidesmosome
E. Adherents junction

Answers

Answer:

Desmosomes 

Explanation:

Desmosomes Connect Intermediate Filaments from Cell to Cell

Through desmosomes, the intermediate filaments of adjacent cells are linked into a net that extends throughout the many cells of a ti

Calculate the percent change of a population of geese that started with 40 individuals.
12 were born and 8 died. 6 geese immigrated into the population.

Answers

Ansew heheheheheheh

Explanation:

7. In an ecosystem, which is the most likely reason for an increase in the producer
population if there is an increase in the carnivore population?

Answers

If there is an increase in coronavirus that means that the animals that eat the producers will be less which causes more producers

4. What is the molecule used by cells to store energy?

Answers

Answer:

What is the molecule used by cells to store energy?

Explanation:

Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.

1. What is the major source of energy for the brain

Answers

Explanation:

glucose

The mammalian brain depends on glucose as its main source of energy. In the adult brain, neurons have the highest energy demand [1], requiring continuous delivery of glucose from blood.

hope its helpful to you #

The major source of energy for the brain is glucose. Metabolism of glucose provides energy to the brain.

What is the brain?

The brain is a body part that operates the various functions of the body. It is present in the head of the body. It is divided into two parts, the left brain, and the right brain.

Energy is something that is produced by the metabolism of food. Energy7 is required to carry out all the processes of the body. To walk, run, work, eat, everything requires energy.

The main source of the energy in animals and plants is glucose. The food we eat converts into energy by the process of respiration. The energy is transported into all parts of the body by blood circulation.

Thus, glucose is the major source of energy for the brain.

To learn more about energy, refer to the link:

https://brainly.com/question/781388

#SPJ2

Which statement best describes energy release in cellular respiration? (1 point)

Stored chemical energy is broken down and released in the cytoplasm.
Stored chemical energy is broken down and released in the cytoplasm.

Stored chemical energy is broken down and released in the mitochondria.
Stored chemical energy is broken down and released in the mitochondria.

Stored chemical energy can be used immediately and is released in the cytoplasm.
Stored chemical energy can be used immediately and is released in the cytoplasm.

Stored chemical energy can be used immediately and is released in the mitochondria.

Answers

Answer:

During cellular respiration, glucose is broken down in the presence of oxygen to produce carbon dioxide and water. The energy released during the reaction is captured by the energy-carrying molecule ATP (adenosine triphosphate).

So the answer is Stored chemical energy is broken down and released in the mitochondria.

Explanation:

In cellular respiration, stored chemical energy is broken down and released in the mitochondria. The correct option is B.

What is mitochondria?

Mitochondria are the membrane-bound organelles that create the maximum of the chemical energy necessary to power the biochemical reactions of the cell.

The mitochondrial energy is stored in a small molecule referred to as adenosine triphosphate (ATP).

Cellular respiration is the way by which organic fuels are oxidized in the presence of an inorganic electron acceptor, encompassing one as oxygen, to give enormous amounts of energy and pressure the majority production of ATP.

Cellular breathing is the way by which cells in plants as well as animals break down glucose and convert it into power, which is then used to perform work.

The goal of cellular respiration is simple: to provide the energy that cells require to function.

Thus, the correct option is B.

For more details regarding cellular respiration, visit:

https://brainly.com/question/13721588

#SPJ5

help please asap!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Basidiomycotes

the second one

Explanation:

ASAP plz
Describe hurricanes and explain how these storms affect human behavior?

Answers

When a hurricane strikes a community, it leaves an
obvious path of destruction. As a result of high winds
and water from a storm surge, homes, businesses, and
crops may be destroyed or damaged, public
infrastructure may also be compromised, and people
may suffer injuries or loss of life.

Which of these forms when air moves in the directions shown by the arrows
in the diagram?

A ) Valley Breeze
B) Land Breeze
C ) Mountain Breeze
D ) Sea Breeze

Answers

Answer:

C.

Explanation:

Please do brainless :)

Mountain breeze refers to the fact that the surface breezes are coming from the mountain and blowing into the lowlands. Thus, option C is correct.

What is the movement of air in mountain breeze?

The air cools during the night and flows into the valley from the mountainside.

As a result, the breeze blows in the other direction; it travels from the mountains to the plains and valley floor. This wind is therefore referred to as the mountain breeze.

As the air rushes in to fill the space, the air pressure decreases and a gust of wind is produced. A valley breeze, on the other hand, develops when cooler air in the valley falls to fill the space left by the warm air rising.

Therefore, Mountain Breeze in which air move from high pressure to low pressure.

Learn more about mountain breeze here:

https://brainly.com/question/12997458

#SPJ5

If you cross two organisms that are heterozygous for a trait, what percent of
the offspring would you expect to express the recessive phenotype?

Answers

Answer:

25%

Explanation:

Here's an example: two chickens have the phenotype of white feathers and brown feathers. What percentage of the chicks will have the recessive color? First, you have to see the parents' phenotypes. Draw a punnet square. Put one of the parent's phenotypes (w and B) on the top, and the other parent's (w and B) on the right side going down. Whichever trait is dominant (brown) MUST be capitalized. Then, cross the two parents. first box on the top left would read 'ww.' The one below it is 'Bw' (put the dominant first). The right top is 'Bw' and the one below it is 'BB'. So if there were 4 offspring, these would be their genotypes: 'ww', 'Bw', 'Bw', and 'BB'. The only offspring that would have the recessive trait is the 'ww' child, because dominant overpowers recessive. So 25% would have the recessive trait and 75% would have the dominant trait.

A birdwatcher wants to identify an eastern bluebird. What feature of a bird should the birdwatcher evaluate first to identify an eastern bluebird?

Answers

Explanation:

In this case, I would suggest looking at the overall color of the bird as well as notable color patches on the wings, tail, or the head.

Also note whether or not the edges where colors meet are blurred or smooth/blended.

Which of the following are important functions of roots?
Roots are where cotyledons emerge.
Roots enable plants to spread over land areas.
Roots hold the plant in place in the ground.
Roots store minerals and carbohydrates for the plant.

Answers

Answer:

roots enable plants to spread over land areas or roots hold the plant in place in the ground

Answer:   Peace ✌

Explanation:  

Peace ✌

A food chain shows how
matter moves through an
ecosystem. Which of these
substances forms the base of
the matter in food chains and
food webs?
A. light
B. carbohydrates
C. iron and lead

Answers

Answer: B

Explanation:

Answer:

carbohydrates

Explanation:

current definition

please help​

Answers

Answer: now or like presently

Explanation:

I dont know

rough endoplasmic reticulum what is and function

Answers

The general function of the endoplasmic reticulum is to produce protiens for the cell to function. The rough ER in particular has many ribosomes on it's surface, while the smooth ER does not. These ribosomes give the rough ER it's distinct appearence under a microscope, and assist in making protiens.

differences between stamen and pistil​

Answers

Stamen is composed of anther and filament. The pistil is composed of stigma, style, and ovary. ... The key difference between stamen and pistil is that stamen is the male reproductive organ which produces pollens of angiosperms while pistil is the female reproductive organ which produces ovules of angiosperms.

I hop this helps!

4. Murphy ends her talk by saying, "It's not about the robots. It's about the data."
What does she mean by this? How is this pertinent to severe weather disasters?

Answers

Answer:

At the end of Murphy's talk she says it's not about the robots it's about the data meaning it is not about the robots but the data collected by the robots . This is relevant to natural disasters because robots can collect data more efficiently and with higher resolution better than we could without them. Also the robots collect this data in just seven hours when it normally takes up to two to three days.

Explanation:

I had the same question in my high school class and got 100%

the role of dna in cellular differentaation

Answers

Answer:

controls the way cells function, also determines what type of specialized cells will be made.

Most Americans/Canada say they hope to die __________.

Answers

i think they hope to die at home

Other Questions
Can someone help with this math problem? aA person throws a ball up into the air, and the ball falls back towarwould the kinetic energy be the lowest? (1 point)at a point before the ball hits the groundwhen the ball leaves the person's hando when the ball is at its highest pointat a point when the ball is still rising 2 H2O 25) Examine the chemical formula shown here. Which of the statements are supported by the information shown here? Select ALL that apply. A) There are six total atoms present B) There are three total atoms present There are a total of two oxygen atoms D) There are a total of four hydrogen atoms E) There are two total atoms present hydrogen and oxygen Answer 1-5 Please and Thankyou! Impressment was a major cause of which war? A) American Revolution B B) French and Indian War Civil War D) War of 1812 a diver is 19 meters below the surface of the water.use an interger to represent how far the diver will need to travel to reacg the surface' Should the government create a law mandating a balanced federal budget? Support your position with evidence from the lesson. Which of the following best describes a major effect of Upton Sinclairs book The Jungle?It created a controversy that led the Supreme Court to break up a monopoly.It created a controversy that influenced President Roosevelt to take action.It exposed the scandal of railroad business practices.It prompted government reform on a state and city level. explain at least one similar characteristic of Egypt and Mesopotamia. Why was this important to the success of these ancient civilizations? what kind of wave is shown A surface, such as a prep table, that touches food or from which food could drip or drain onto surfaces that touch food iscalled a "food-splash surface."TrueFalse how how does absorption of materials play a role in diffusion 14. Which transformation from the graph of a function f(x) describes the graph of 10f(x)? 2. ( Responses: horizontal, vertical) 2. ( Responses: shift, stretch) 2. ( Responses: up, down, left, right, by a factor of) 10 units. 2. Answer it and then explain it please A book store is hosting a special night in which familles can enjoy a story and craft time. Tickets to the event must be bought ahead of time and are $1.50 for children and $2.50 for adults. So far, 45 children's tickets have been sold, which is 60% of the total tickets sold. How many tickets have been sold so far? Show or explain how you got your answer.steps please A sum of $1290 is to be divided between two people in the ratio of 7 to 8. How much does each person receive? In the early days of the game industry, nearly all games were developed by designers, for designers. More specifically, what age-range/gender were the designers, and for what age-range/gender were they designing the games for? Which term has the definition "A relationship in which two variables change at the same rate Identify and explain whether or not India experienced relative progress or decline under British rule. PLEASE HELP WILL MARK BRAINIEST!!!!!!! how long does it take to get unemployment check after claiming weeks