Indicate the oxidation number of carbon and sulfur the in following compounds.Procedurea. CO b. CO2 c. Na2CO3d. Na2C2O4 e. CH4 f. H2COg. SO2 h. SO3 i. Na2SO4j. Na2SO3 k. Na2S2O3 l. Na2S4O6m. SCl2 n. Na2S2 o. SOCl2

Answers

Answer 1

Oxidation number of C is a) +2 b) +4 c) +4 d) +3 e) -4 f) 0 g) +4 h) +6 i)+6

j) +4 k) +2 l)2.5 m) -2 n)  -1  o) +4

A) CO

x + (-2) = 0

Thus, x = +2

Oxidation number of C = +2

B) CO2

x + 2 (-2) = 0

x = +4

Oxidation number of C = +4

C) Na2CO3

2 (+1) + x + 3(-2) =0

2 + x -6 = 0

x = +4

Oxidation number of C = +4

D) Na2C2O4

2(+1) + 2x + 4(-2)

2x = +

x = +3

Oxidation number of C = +3

E) CH4

x + 4(+1) = -4

Oxidation number of C = -4

F) H2CO

2(+1) + x (-2) =0

x = 0

Oxidation number of C = 0

G) SO2

x + 2 (-2) = 0

x = +4

H) SO3

x + 3(-2) = 0

x = +6

I) Na2SO4

2(+1) + x + 2(--4)

x = +6

K) Na2SO3

2(+1) + x + 3(-2) =0

2 + x -6 = 0

x =+4

K) Na2S2O3

2(+1) + 2x + 3(-2) =0

2x = +4

x = +2

L) Na2S4O6

2(+1) + 4 x + 6(-2) =0

4x = 10

x = 2.5

M)SCl2

x + 2(-1) = 0

x = -2

N) Na2S2

2(+1) + 2x = 0

x = -1

O) SOCl2

x + -2 + 2(-1)

X = +4

An atom's hypothetical charge, or oxidation number, would be zero if all of its links to other atoms were completely ionic. It describes how much an atom in a chemical compound has oxidised (lost electrons). The oxidation state could theoretically be zero, positive, or negative. Owing to the fact that many bonds in nature exhibit high ionicity despite the absence of fully ionic bonds, the oxidation state is a good indicator of charge.

Learn more about Oxidation number here:

https://brainly.com/question/29263066

#SPJ4


Related Questions

why is it important to perform the fractional distillation slowly? what happens if a fractional distillation is done very quickly by rapidly raising the temperature of the heat source?

Answers

To accomplish a satisfactory separation, a slow, even distillation is required since only under these circumstances can vapor and liquid in the distillation apparatus be in balance with one another.

What justifies using a slow fractional distillation process? What would occur if it was completed too soon?

The best equilibration and heat transport can essentially be achieved through slow, steady distillation. If you heat the mixture too quickly, the vapors could not condense as quickly as you'd want, wasting some of the column. Packaging supplies are also essential. Packing materials with a large surface area give surfaces on which condensation can happen.

How does too-rapid distillation affect the process?

Additionally, bumping may happen if the distillation proceeds too quickly. -The target liquid's vapors condense too soon and fall back into column.

To know more about fractional distillation visit:-

https://brainly.com/question/29037176

#SPJ4

if we were to arrange these elements in order based on the number of bonds they form, what order would we put them in?

Answers

The order formed from least to most: H< O<N <C<P<S which is determined by the valence electrons.

The octet rule is a chemical rule of thumb that displays the concept that main-institution factors have a tendency to bond in this sort of manner that every atom has 8 electrons in its valence shell, giving it the equal digital configuration as a noble gas. Octet rule states that atoms tend to form compounds in a way that eight valence electrons.

Elements Valence electrons

C 4

H 1

N 5

O 6

P 5

S 6

Number of bonds formed from least to most: H< O<N <C<P<S

Since, P and S has d -orbitals, they can form more number of bonds.

To learn more about valence electrons check the link below:

https://brainly.com/question/28337734

#SPJ4

the group 16 elements have the general valence electron configuration ns2npx . what is the numerical value of x ?.

Answers

The numerical value of x is 4 for the elements belonging to group 16.

The outermost shell or orbital of an atom is called its valence shell. The electrons in these shells take part in bonding with other atoms. It may be fully filled or half-filled. The group 16 elements have the general electronic configuration ns2 npx. The general valence electron configuration of group 16 elements is ns2 np4. Group 16 elements have six electrons in their valence shell. Thus, the value of x=4.

The group 16 elements are oxygen (O), Sulfur (S), Selenium (Se), Tellurium (Te), Polonium (Po) etc.

Thus, the valence electrons will be same for the elements is ns2 np4 and therefore the numerical value of x is 4.

To learn more about valence electrons check the ink below:

https://brainly.com/question/371590

#SPJ4

Label The Functional Groups In The Molecule.Label The Image Of A Compound Light Microscope Using The Terms Provided.

Answers

The the NH₂ group in the given compound is called amino group and the Cl group is chloride. The functional group C=O is called ketonic group. The COR in the first end is called an alkoxy group and the functional group OH is called hydroxy group.

What are functional groups?

Functional group in an organic compounds are groups with heteroatoms such as N, O, halogens etc. The organic compounds are named based on the position of these functional groups in the compound. Their prefix or suffix are given to the name.

The functional group OH is called hydroxyl group and the group COR is an ether or alkoxy group. The C=O group is called a carbonyl or ketonic group.

The the NH₂ group in the given compound is called amino group and the Cl group is chloride. The compound contains hydroxyl group, alkoxy group and bromide group also.

To find more on functional groups, refer here:

https://brainly.com/question/14618322

#SPJ4

What is the pathway of an enzyme?

Answers

Enzyme is the protein that catalyzes a biological chemical reaction. Pathways of enzymes called metabolic pathways that convert a substrate molecule through a series of metabolic intermediate.

The pathways of enzyme called metabolic pathway is a series of interconnected biochemical reactions that convert a substrate molecule or molecules through a series of metabolic intermediates yielding a final product or products. Chemical reactions in metabolic pathways rarely take place spontaneously. Each reaction step is catalyzed by a protein called an enzyme. Enzymes are important for catalyzing all types of biological reactions. Those that require energy as well as those that release energy. This involves two pathways. Anabolic pathways and catabolic pathways. Anabolic pathways synthesize molecules and require energy. Catabolic pathways break down molecules and produce energy.

To learn more about Metabolic Pathways please visit:

https://brainly.com/question/14041305

#SPJ4

what is the hybridization of all the atoms (other than hydrogen) in each of the following species?

Answers

Hybridization is the concept of when two atomic orbitals mix up to give rise to a new type of hybridized orbitals. This intermixing of orbitals oftenly results in the formation of hybrid orbitals having entirely different energies, shapes, etc.

According to the question , Here the hybridization of the given atoms are:

1] For HCN, there are TWO electron groups surrounding the central carbon atom: a single C-H bond and a triple C-N bond. The carbon atom in HCN is therefore sp hydribidised.

2] In HCN there is a triple bond between carbon and nitrogen. A triple bond consists of the end-to-end overlap of two sigma bonds and the side-to-side overlap of two unhybridized p-orbitals. Therefore, in this case nitrogen has sp hybridization.

3] For NH₄⁺ : Since the geometry is tetrahedral, the hybridization is sp3.

4] For CH₃⁻ is sp3,

5] CH₃⁺ is sp2.

6] NH₃ hybridization is sp3

7] C[CH₃]₄ the hybridization is sp3.

8] H₃O⁺ ion, here O is sp3 hybridized

The given question is incomplete and the completed question is given as,

What is the hybridization of all the atoms (other than hydrogen) in each of the following species? HCN, NH₄⁺, CH₃⁻, CH₃⁺, NH₃, C[CH₃]₄, H₃O⁺.

Learn more about hybridization from the link given below.

https://brainly.com/question/14218124

#SPJ4

a 2.5000 g sample of epsom salt (maghesiun sulfate hydrate) is heated until the crystals arereduced to a dry powder. after cooling the residue was found to weigh 1.7525 g. calculate g

Answers

The mass of the water of crystallization is 0.7475 g.

What is the mass of the water?

We know that a hydrated compound is a compound that contains in it the water of crystallization. This is the water that becomes attached to the structure of the compound that is in question.

In this case, we have that the salt that is question is a hydrate of magnesium sulfate and we have.

Mass of the hydrated salt =  2.5000 g

Mass of the anhydrous salt =  1.7525 g

Mass of water present = 2.5000 g - 1.7525 g

= 0.7475 g

Learn more about water of crystallization:https://brainly.com/question/29442515

#SPJ1

Missing parts;

A  2.5000 g sample of epsom salt (maghesiun sulfate hydrate) is heated until the crystals arereduced to a dry powder. after cooling the residue was found to weigh 1.7525 g. calculate the mass of the water.

The Figure shows the elements of Period 3 and the first 3 elements of Group 6A of the Periodic Table. Use the Figure to answer questions 10 and 11.

10.Which of the elements have atomic radii larger than S? Select all that apply

A. Al
B. CI
C. Na
D. O
E. P
F. Se

Answers

The elements that have atomic radii larger than S are Al, Na, P, and Se.

The correct options are A, C, E, and F.

What are the atomic radii of elements?

The atomic radii of elements are defined as the distance between the nuclei of two covalently bonded nuclei of atoms of elements.

Atomic radii of elements show periodicity.

The atomic radii of elements increase from top to down in a group in the periodic table whereas the atomic radii of elements decrease from left to right across a period in the periodic table.

Comparing the atomic radii of sulfur, S, and the given elements:

Al has a larger atomic radii

Cl has a smaller atomic radii

Na has a larger atomic radii

O has a smaller atomic radii

P has a larger atomic radii

Se has a larger atomic radii

Learn more about atomic radii at: https://brainly.com/question/12131433

#SPJ1

What are the 4 types of weathering?

Answers

Answer: The four main types of weathering is I think, Chemical, Physical, Biological, and Mechanical weathering. But if you're talking about main agents then it will have to be water, ice, air, and temperature.

Explanation:

Hope this helps! Tried my best.

now consider this plot, which shows the boiling points of all the common compounds between p-block elements and hydrogen. what are the formulas of the two other compounds (besides water) that experience hydrogen bonding?

Answers

Separation of two molecules joined by a hydrogen bond requires 10 to 30 kJ mol–1, roughly 10 times the energy needed to overcome dipole forces. Thus hydrogen bonding can account for the unusually high boiling points of NH3, H2O, and HF

Which of the following ch3 ch2 ch3 ch3 ch3 br does have the highest boiling point?

The listed compounds have molecular weights between 44 and 46.Extensive intermolecular H-bonding occurs in CH3CH2OH, which causes molecules to link together.It has the greatest boiling point as a result.

Which substance among CH3CH3 B CH3OCH3 C CH3CH2OH D ch3cooh has the greatest boiling point?

Alcohols have an extremely high boiling point due to their hydrogen bonds.Since ethanol experiences a lot of hydrogen bonding, it has the hottest boiling point.

To know more about hydrogen bonding visit:

https://brainly.com/question/15099999

#SPJ4

What are 4 ways to identify an ionic compound?

Answers

Answer:

Binary Ionic Compounds Containing a Metal and a Nonmetal. A binary compound is a compound formed from two different elements. ...

Ionic Compounds Containing a Metal and a Polyatomic Ion. Metals combine with polyatomic ions to give ionic compounds. ...

Acids and Acid Salts. ...

Binary Compounds Between Two Nonmetals.

Explanation:

Practice Problem 05.38a Draw the enantiomer of the following compound: Cl OH 2

Answers

The enantiomer of the compound: ClOH₂

Identify the chiral center in the compound. The chiral center is a carbon atom bonded to four different groups.Draw the compound, making sure to include all the atoms and bonds.Flip the compound horizontally.

What is an enantiomer?

Generally, To draw the enantiomer of a compound, you need to flip its chiral center, which is a carbon atom bonded to four different groups. In the compound you provided, ClOH, there is no chiral center.

Therefore, there is no enantiomer.

If you have a compound with a chiral center and you want to draw its enantiomer, you can follow these steps:

Identify the chiral center in the compound. The chiral center is a carbon atom bonded to four different groups.

Draw the compound, making sure to include all the atoms and bonds.

Flip the compound horizontally.

For each bond to a chiral center, swap the two groups attached to that bond.

For example, the compound (S)-2-chlorobutane has a chiral center at the carbon atom bonded to a chlorine atom, a hydrogen atom, and two methyl groups (-CH₃). To draw its enantiomer, (R)-2-chlorobutane, we can follow these steps:

Identify the chiral center.Draw (S)-2-chlorobutane:H₃C-CH₂-ClFlip the compound horizontally:Cl-CH₂-H₃CSwap the two groups attached to the bond to the chiral center:H₃C-CH₂-Cl

The resulting compound is (R)-2-chloroquine.

Read more about enantiomer

https://brainly.com/question/21506956

#SPJ1

What is the mass in grams of 4 mol C8H18?

Answers

Answer:

457.04 g

Explanation:

Molar mass of C8H18 is 8(12.01) + 18(1.01) = 114.26 g/mol

mass of 4 mol = 4(114.26) = 457.04 g

Can you put lemonade in a silver pitcher?

Answers

Yes we can put lemonade in a silver pitcher.

What  is Acid ?

Acidic substances are typically easy to recognise by their sour flavours. A molecule that can donate an H+ ion and keep its energetic favorability even after losing H+ is a basic definition of an acid. Blue litmus paper is known to turn red when exposed to acids.

Bases, on the other hand, have a smooth consistency and a bitter flavour. A base that may dissolve in water is known as alkali. When these substances interact chemically with acids, salts are created. Red litmus has a history of becoming blue on bases.

The definitions of the terms acid and base vary depending on how one chooses to see the properties of acidity and basicity.

Yes, acidic fruit juices like orange or lemon juice have an interaction with silver in that they help to eliminate some types of surface discoloration that may develop. Because of this, jewellers soak jewellery in a moderate acid for 5 to 15 minutes to remove these coatings off the surface of the silver, among other things.

In order to prevent these dissolved chemicals from getting into your juice, it is a good idea to polish and then completely wash the silver pitcher or other silver crockery before use. Although it isn't particularly harmful, it might alter the flavor;)

Learn more about Acid from given link

brainly.com/question/25148363

#SPJ4

Please answer the 12 steps thank you Design a synthesis of 3-cyanocyclopentanol from cyclopentanol. OH OH CN Part 1 out of 12 ces Choose the best option for the immediate precursor to the target molecule. OH

Answers

The chemical equations showing synthesis of  3-cyanocyclopentanol from cyclopentanol is attached in the image below.

What is chemical equation?

Chemical equation is a symbolic representation of a chemical reaction which is written in the form of symbols and chemical formulas.The reactants are present on the left hand side while the products are present on the right hand side.

The first chemical equation was put forth by Jean Beguin in 1615.By making use of chemical equations the direction of reaction ,state of reactants and products can be stated. In the chemical equations even the temperature to be maintained and catalyst can be mentioned.

Learn more about chemical equation,here:

https://brainly.com/question/28294176

#SPJ4

How many mol are in a Mg?

Answers

The molar atomic mass of magnesium is given as 24 g mol⁻¹.

Molar mass of a substance is defined as the mass in grams of one mole of the compound. In any substance, the total amount of entities present e.g. atoms, molecules, ions, is defined as a mole. A mole of any substance is equal to 6.022×1023 molecules or atoms.

The molar mass of a compound is basically calculated by adding the quality atomic masses (in g/mol) of the constituent atoms. For example, the mass of titanium is 47.88 amu or 47.88 g/mol. In 47.88 grams of titanium, one mole or 6.022 x 1023 titanium atoms are present.

As molar atomic mass of magnesium is 24 g mol⁻¹ so, one mole of magnesium weighs 24.31 g.

Learn more about molar masses from the link given below.

https://brainly.com/question/20022583

#SPJ4

Search and find 5 applications of Neutralisation reaction and draw a mind map for the
same.

Answers

Answer:

Wasp stings

For tummy aches and high acidity in the stomach

Tooth decays

To treat soils which are acidic

Bee stings

3) Identify the noble gas in the following list A) helium B) nitrogen C) oxygen D) gold E) chlorine 4
) The atomic number of an atom is equal to the number of A) nuclei B) neutrons C) neutrons plus protons D) electrons plus protons E) protons
5) Consider a neutral atom with 30 protons and 34 neutrons. The atomic number of the elementis A) 30 B) 32 C) 34 D) 64 E) 94
6) How many proton are in an isotope of sodium with a mass number of 25% B) 14 C) IS D) 25 E) 32 Isotopes are stoms of the

Answers

Helium is the noble gas out of the following options given.

The amount of protons an atom contains determines its atomic number.

The atomic number of a neutral atom with 30 protons and 34 neutrons is 30.

An isotope of sodium with a mass value of 25 has 11 protons.

Gases that are noble or inert. Helium, neon, argon, krypton, xenon, and radon are the noble gases, or inert gases, that make up group 8A (or VIII A) of the periodic table. The name of these elements refers to how little they react with other elements or compounds.

The atomic number is determined by the number of protons, which is always equal to the number of electrons in a neutral atom.

Sodium has an atomic number of 11. Since the atomic number in this instance is 11, the number of protons is likewise 11. The number of protons is equal to the atomic number.

To know more about atomic number click on the link below:

https://brainly.com/question/621740

#SPJ4

What are the 4 types of bonds in chemistry?

Answers

The four types of bonds in chemistry are ionic , covalent , hydrogen and polar covalent bond.

Generally the elements have an incomplete octet or an incomplete duplet . In order to gain noble gas configuration these elements reacts with each other to complete their octet or duplet.

This leads to formation of bond between them.

Bonds are formed either by losing an electron or by gaining an electron. Metal loses electrons forming cations whereas non metals gain electrons forming an anion.

Hydrogen bond is a weak bond in nature as they are based on Van der walls force of attraction whereas the others are strong bonds.

To learn more about bonds

brainly.com/question/10777799

#SPJ4

What is the concentration of solution if 20gm solid dissolved in 180 gm of water?

Answers

Calculate the concentration in terms of mass by solution mass % for a solution that has 20g of sugar dissolved in 180g of water.

The answer is that 20g of sugar dissolves in 180g of water. 180g plus 20g equals 200g for the solution's total mass.

Mass of the solute / Total mass of the solution 100, i.e. 20/200 100 = 10%, is how you calculate the mass by mass percentage of the solution.

What dissolves in water?

Coffee, salt, and sugar are a few items that can dissolve in water. These things break down. Usually, warm or hot water makes them dissolve more quickly and readily. Sand and pepper are both soluble in hot water, but not at room temperature.

To know more about Dissolved visit:

brainly.com/question/2364287

#SPJ4

Which will have higher boiling point 0.1 m NaCl or 0.1 m bacl2 solution in water?

Answers

When comparing the boiling points of 0.1 m NaCl and 0.1 m BaCl2 solutions in water, it is important to note that NaCl has a higher boiling point.

What is boiling point?

Boiling point is the temperature at which a liquid changes state from liquid to gas. At this temperature, the vapor pressure of the liquid is equal to the atmospheric pressure, and the liquid is said to be at its boiling point. Boiling point can vary depending on the atmospheric pressure, which is affected by elevation and weather. Generally, the higher the atmospheric pressure, the higher the boiling point of the liquid.
This is because NaCl is an ionic compound, which means it is composed of charged particles that form strong bonds with each other. These bonds are much more difficult to break than the weaker hydrogen bonds that form between molecules in BaCl2. Therefore, the boiling point of 0.1 m NaCl solution in water will be higher than the boiling point of 0.1 m BaCl2 solution in water.
To know more about boiling point click-
https://brainly.com/question/40140
#SPJ4

created a standard curve and calculated the slope to be 65.2. after synthesizing your copper network, you weighed 0.055 grams of your copper product, worked it up with nitric acid, buffer, and ammonia and added it to a 25 ml volumetric flask. then, you measured the absorbance of your solution and received a value of 0.323. what is the % mass of copper in your product?

Answers

The % mass of copper in your product will be 3.64 %.

Calculated slope = 64.5

Mass of copper product = 0.055 g

Initial volume (V1) = 25 ml

Final volume (V2) = 100 ml

Absorbance (A) = 0.323

% mass of copper = ?

To find out the concentration (C) we use the following equation

C = A / slope

Put the values

C (M2) = 0.323 / 64.5

C (M2) = 0.00501 g/L

To calculate M1 we use the following equation.

M1V1 = M2V2

M1 = 0.00501 * 100 ml / 25 ml

M1 = 0.02004 g/L

mass of copper = Penny solution x Volume

mass of copper  = 0.02004 g/L x 0.1 L

mass of copper = 0.002004 g

% mass of copper = (total mass of copper ÷ mass of penny) x 100

% mass of copper = (0.002004 / 0.055 ) x 100

% mass of copper = 3.64 %

You can also learn about percent mass from the following question:

https://brainly.com/question/5394922

#SPJ4

A valence issue is an issue ______.

Answers

A valence issue is an issue  on which most voters and candidates share the same position.

A valence issue is one on which the majority of voters are in agreement. Voters use valence issues to assess a political party's effectiveness in achieving a particular goal or quality because valence issues are symbolic of such things.

The valence issue notion is a technique of speculating on the reasons why voters support opposing parties in a general election. The theory was developed in response to Donald Stokes' critique of theories of voting behavior, which Stokes considered as being excessively limited to notions of a voter's reasoning and ideological impulses, as with spatial models of party competition. Since Stokes noted that voters occasionally were not constrained by ideology or self-interest during his assessment of past U.S. elections.

To learn more about Valence Please click on the given link:

https://brainly.com/question/371590

#SPJ4

A method for determining the quantity of dissolved oxygen in natural waters requires a series of redox reactions. Balance the following chemical equations in that series under the conditions indicated (and include phases):

a. in basic solution
Mn^(2+) (aq) + O2 (g) ---> MnO2 (s)
b. in acidic solution
MnO2 (s) + I^(-) (aq) ---> Mn^(2+) (aq) + I2 (s)
c. in neutral solution
I2 (s) + S2O3^(2-) (aq) ---> I^(-) (aq) + S4O6^(2-) (aq)

Answers

Balance the following equation:

in basic solution: Mn²⁺ (aq) + O₂ (g) + 4OH⁻(aq) → MnO₂ (s) + 2H₂O (l)in acidic solution: MnO₂ (s) + I⁻ (aq) + 4H ⁺ → Mn²⁺ (aq) + I₂ (s) + 2H₂O (l)in neutral solution: I₂ (s) + 2S₂O₃²⁻(aq) → 2I⁻ (aq) + S₄O₆²⁻ (aq)

A chemical equation is a symbolic writing of a chemical reaction. The chemical formulas of the reactants are written to the left of the equation and the chemical formulas of the products are written to the right

In basic solution:

Step-1: The number of Mn and O atoms on both sides is checked. They are equal.Step-2: The charges are looked in. The left-hand side (LHS) has net 2+ on Mn the Right-hand side (RHS) has a net O charge. Since it is a basic reaction, we neutralize the charge on Mn2+ (LHS) by adding 2 negative charges ie, 2 OH⁻ ion ⇒ Mn²⁺ + O₂+ 2OH⁻ → MnO₂Step-3: The newly introduced H on LHS is balanced on RHS by inserting a respective number of water molecules. ⇒ Mn²⁺ + O₂ + 4OH⁻ → MnO₂ + 2H₂O.Step-4: Toy to balance the number of O, H, and then Mn. ⇒ Mn²⁺ (aq) + O₂ (g) + 4OH⁻(aq) → MnO₂ (s) + 2H₂O (l)

In acidic solution:

Step-1:  Balance number of atoms: (O by adding H₂O)Step-2: Balance the charges by adding protons and electronsStep-3: Combine LHS and R.H.S of both equations Canal out electrons. ⇒ MnO₂ (s) + I⁻ (aq) + 4H ⁺ → Mn²⁺ (aq) + I₂ (s) + 2H₂O (l)

in neutral solution:

It doesn't involve any proton or hydroxide ion in the reaction. There is no 2S₂O₃²⁻ ion and S₄O₆²⁻, the correct form is S₂O₃²⁻ and S₄O₆²⁻. This reaction comes in the third series of the Winkler method of determining Dissolved Oxygen.

Learn more about balance the equation at https://brainly.com/question/11904811

#SPJ4

Alcohols: SN2 reaction of 1-bromobutane and EtoNa 12 of 19 Review Constants Periodic Table Part A Predict the major organic product formed when the compound shown below undergoes a reaction with EtONa. Br

Answers

Option (B) 3-dimethylbutan-2-amine is the primary organic product generated by the following process.

It should be emphasized that the ketone and primary amine reaction takes place in an acidic buffer. The primary organic product of this reaction is ethyl chloride. Carbohydrates, fats (lipids), proteins, and nucleic acids are examples of organic chemicals that serve as the foundation for life's molecules. Petroleum and natural gas, which are the major components of fossil fuels, are also organic molecules. The addition of hydrogen bromide to propene yields 2-Bromopropane. As a result, option B is the correct answer. 3-dimethylbutan-2-amine is the primary organic product generated by the following process.

Learn more about reaction here-

https://brainly.com/question/28984750

#SPJ4

What is the mass of 0.45 mol of ammonium sulfate, (NH4)2SO4?

Answers

Answer:

59.46 g

Explanation:

To answer this question, the molecular weight of ammonium sulfate must be computed.  To accomplish this, the weights of the individual elements must be noted.
N=14.01[tex]\frac{g}{mol}[/tex]

H=1.01[tex]\frac{g}{mol}[/tex]

S=32.07[tex]\frac{g}{mol}[/tex]

O=16.00[tex]\frac{g}{mol}[/tex]

To compute the molecular weight:

[tex]2[14.01\frac{g}{mol}+4(1.01\frac{g}{mol})]+32.07\frac{g}{mol}+4(16.00\frac{g}{mol})=132.14\frac{g}{mol}[/tex]

To calculate the mass:

[tex]0.45 mol(\frac{132.14g}{1mol})=59.463g[/tex]

as temperature increases, what happens to the viscosity of water? explain why this occurs, in terms of molecular interactions and the effect of changing temperature

Answers

The molecules move more quickly as the temperature rises, and their kinetic energies are better equipped to overcome the forces holding them together. As a result, the viscosity of the liquid reduces.

Why and what will happen to the viscosity when the temperature rises?

Because particles interact more quickly and for shorter periods of time as temperature rises, viscosity will also decrease because internal friction or stress will be reduced.

How does a fluid's viscosity change as its temperature changes?

The molecules become more mobile when the temperature rises due to an increase in kinetic or thermal energy. Reduced viscosity results from a decrease in the attractive binding energy.

To know more about viscosity of water visit :-

https://brainly.com/question/2193315

#SPJ4

Can you put fruit in a pewter bowl?

Answers

Absolutely! Utilize those lovely dishes to the fullest. Always keep in mind that any acidic food, such as tomatoes, oranges, and vinegars, will create spots on pewter, just like they do on sterling.

Pewter can you put fruit on it?

Cut flowers should not be placed inside a jug if you want to use it for something else. Additionally, avoid storing acidic foods or fluids in pewter for extended periods of time since this may cause the metal to tarnish.

Can you use Mexican pewter in cooking?

Any form of meal, including salads, can be prepared in Mexican pewter. Both the refrigerator and the oven are compatible with it. Although it is not advised for baking, the majority of Mexican Pewter products are authorized for a maximum temperature of 350 degrees Fahrenheit.

To now more about pewter bowl visit:-

https://brainly.com/question/29627686

#SPJ4

Complete the reaction, which is part of the electron transport chain. the abbreviation q represents coenzyme q. use the appropriate abbreviation for the product.

FADH2+Q →

Answers

The reaction, which is part of the electron transport chain. the abbreviation Q represents coenzyme Q. use the appropriate abbreviation for the product : FADH₂  +  Q ---->   QH₂   +  FAD

The reaction, which is part of the electron transport chain. the abbreviation Q represents coenzyme Q. use the appropriate abbreviation for the product :

FADH₂  +  Q ---->   QH₂   +  FAD

in this reaction ,the  FADH₂ is oxidize. as we all know that that loss of electron is oxidation. the  FADH₂ is acts as a reducing agent. The Q gains the electron and gets reduce because gain of the electrons is called as the reduction and act as a oxidizing agent.

To learn more about electron transport chain here

https://brainly.com/question/17094380

#SPJ4

Chromium can help you build bigger muscles and stay lean when you are lifting weights.

True or False?

Answers

False; Chromium can help you build bigger muscles and stay lean when you are lifting weights.

With an atomic number of 24 and the chemical symbol Cr, chromium is a chemical element. It is the first part of group 6. It is a steely-gray, strong, brittle transition metal that is shiny. [4]

The great corrosion resistance and hardness of chromium metal make it valuable. It was a big development in the production of steel when it was realised that steel could be converted into stainless steel, which has a high resistance to rust and discolouration. 85% of commercial use is made up of chrome plating (chromium electroplating) and stainless steel combined. Chromium is highly valued as a metal because it can be polished to a high degree while maintaining its brilliance. Polished chrome reflects about 70% of the visible spectrum and over 90% of infrared radiation.

Learn more about Chromium here:

https://brainly.com/question/681602

#SPJ4

Other Questions
What were the 3 Populist Party beliefs? The five-factor model of personality:is supported by the results of projective tests.is supported by genetic markers.has proven useful across the life span in many cultures.is not well supported. Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 0.000 $20.000 530 000 S40 Task Instructions x Honolulu Denver Add the alternative text Cost forecast for three years and four cities to the chart. 1:35 AM 4 4U 325/2020 100% ^ (1) ENG 1:35 AM 11/30/2020 AUSWADUI LUULEL Attempts Remaining 7 Submit PB Forecast Excel Sign in File Home Insert Page Layout Formulas Data Review View Tell me what you want to do Askar Com General 28 O IU Insert Delete Format 14 29 Wrap Test B.O.A. s E Merge Center Alge > Cost Forecasts by City - Kitchens $ . % 4 Conditional Formatas Call Formatting Tata Styles Norber - Autocom - COR Sortid Clear Filter Set Editing board Font H M O Precision Building Cost Forecast by City Cost Forecasts by City - Kitchens City Year 2020 Year 2021 Year 2022 $43.000 $44000 $45,000 550.000 $65.000 $67.000 $38.000 $40 000 $43.000 $5.500 $55.000$$7.500 Atlanta, GA Boston, MA Denver CO Fionolulu, HI 2011 Based on 150 sq. ft. Kitchen S. . 50 Honolulu Denver Task Instructions Forecasts Add the alternative text Cost forecast for three yem and four cities to the chant. Type here to search i 1252 O DI How can I get my SSS verification slip online? What were the goals of the US in Afghanistan? What are 3 interesting facts about the Taj Mahal? identify the conclusions that can be drawn from the given premises using existential generalization. (check all that apply.)Check All That Apply a. There exists a non-six-legged creature that eats a six-legged creature. b. There does not exist a non-six-legged creature that eats a six-legged creature. c. There exists a noninsect that eats an insect d. There does not exist a noninsect that eats an insect. if you are in a low-speed collision, when your vehicle is repaired, be sure to have your replaced. Who described the flow of blood through the heart? [tex](5-\sqrt{5}) and (\sqrt{5} -5)[/tex]Are two roots of a fourth degree polynomial with integer coefficients, what are the other roots? Why do we need to be worried about chemical safety? Which type of nutrient helps maintain healthy skin and hair?A) carbohydrateB) proteinC) fatD) starch according to the international phonetic alphabet (ipa), what is the label given to consonants in which there is a much wider passage of air resulting in a smooth (as opposed to turbulent) airflow? What is one role of Congress in determining the federal budget evaluating? find the measure of angle b What was the role of the black church during the civil rights movement? What is an example of a risk control method used in a workplace? What are the 5 hazard forms? 5. (8.51) What is the equation of the line shown?HELP PLEASE!!