Answer:
Expired food and drugs; expired food and drinks that has stayed beyond the appropriate time
Impure water; impure water is dirty water that is not fit for the body system
Unripe fruits; fruits that is not yet due for...
Infested food
Poorly cooked food
Cigarette
Explanation:
Atoms of A decay to atoms of B with a half-life of 200,000 years. If there are 20,000 atoms of A to begin with, how long will it take for there to be 2,500 atoms of A?
Answer:
The correct answer is: 600,000 years
Explanation:
Half-life is the time which is essential or required to decrease a specific substance to half of its initial amount of the substance. So, if a substance has a half-life of 200,000 years then it means it takes 200,000 years to decrease or change into a new substance and remain half of its initial quantity.
half-life amount
0 20000
1 10000
2 5000
3 2500
total half-life = 3 to 2500 atoms of A
so, the time will be = 3 * 200,000 years
= 6000000
What do the dotted lines, indicated with the arrow, represent in the DNA model above?
The junctions of codons between individual strands
The bond between deoxyribose molecules and phosphates
The monomers that make up a polymer
The hydrogen bond between complimentary nucleotides
Answer:
The hydrogen bond between complimentary nucleotides.
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answer:
what I don't understand what is the Ctcagt
please help me with this question:)
That is the nucleus!
Hope this helpeddd
Answer:nucleus :)
Explanation:
True or false?
An apple, potato, and onion all taste the same if you eat them with your nose plugged
Answer:
True
Explanation:
Answer:
True
Explanation:
It is frequently quoted that upwards of 80% of our taste is made up by smell. So if you plug your nose and cover your eyes, the taste between an apple and onion should be indistinguishable. Potato's will also taste the same .
what makes stem cells different from cells in the body
Answer:
Stem cells are the body's raw materials
Explanation:
Stem cells are the body's raw materials — cells from which all other cells with specialized functions are generated. Under the right conditions in the body or a laboratory, stem cells divide to form more cells called daughter cells.
Stem cells are different from the other body cells as these are unspecialized cells which can undergo division and renew on their own. The stem cells can undergo specialization by the process of cellular differentiation.
What are Stem cells?Stem cells can be defined as the body's raw materials. These are the cells from which all the other cells with specialized functions are generated.
Embryonic stem cells are the pluripotent stem cells derived from the inner cell mass of a blastocyst. Blastocyst is an early-stage pre-implantation embryo. Human embryos reach the blastocyst stage in 4 to 5 days post fertilization, at which time they consist of 50 to 150 cells.
Stem cells are different from the other cells in the body in three ways which are the stem cells can divide and renew themselves over a long time. Stem cells are unspecialized cells, so they cannot do specific functions in the body unless they undergo cellular differentiation. Stem cells have the potential to become specialized cells, such as muscle cells, blood cells, and brain cells by undergoing cellular differentiation.
Learn more about Stem cells here:
https://brainly.com/question/25584485
#SPJ2
Consider the food chain grasshopper mouse snakes hawks. If snakes go extinct what will happen to the food chain
Answer:
This can actually cause a major problem if the number of grasshoppers were to increase out of control. They eat plants and the number of plants,which are the basis of the food chain, could severely decrease which would impact all of the levels operating above this trophic level.
Answer:
Lack of mice
Explanation:
If the grasshopper where to go extinct the mice population would decrease. Which would lead to it being harder for snakes to find food or they would begin to rely on a different food source. But the hawks would be able to find less snakes but would overall be fine.
Which phase of the Moon rises in the east as the Sun rises in the east
Answer:
Rise, Transit and Set time
Explanation:
how did the settlers view panther when they came to north America
Answer:
They viewed the Panther with fear and set out on a mission to exterminate it.
Explanation:
The first Spanish conquistador to ever sight a Panther was Alvar Nunez Cabeza de Vaca in 1513. When he saw the panther which he referred to as a lion, he was fearful of the animal. He and other Europeans set out on a mission to exterminate all Panthers. This was also necessary as they had to clear the bushes for them to reside.
In 1821 when Florida officially became a part of the United States, and people had to relocate there, a $5 dollar bounty was placed on every Panther killed. The Panthers relocated farther into the wild. As of 1990, the population of the Panther was just around 50. Panthers have since been named an endangered species.
Explain how photosynthesis and cellular respiration work together.
Answer:
photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.
We find DNA on the ___, In every living cell that an organism owns
a. chromosomes
b. reproduction
c. mitosis
Answer:
A. Chromosomes
Explanation:
A Chromosome is some thing carrying genetic information in the form of genes.
We find DNA on the chromosomes, in every living cell that an organism owns. So, the correct option is A.
What is Chromosome?The word chromosome comes from the Greek words for color (chroma) and body (soma). Chromosomes are so named because they are cell structures, or bodies, that are strongly stained by certain color dyes used in research.
Chromosomes are defined as structures found inside the nucleus of a cell that are organized into genes from proteins and DNA. Each cell normally has 23 pairs of chromosomes.
These are threadlike structures which are made of protein and a single molecule of DNA that serve to carry the genomic information from cell to cell.
Therefore, the correct option is A.
Learn more about Chromosomes, here:
https://brainly.com/question/10234301
#SPJ6
name one human hormone that is produced by genetically modified bacteria
Answer:
Insulin
Explanation:
I knew the answer, but I'm not really good at explaining these so I got a little help from google. -------- Bacterial cells can be genetically modified so that they have the gene for producing human insulin. As these modified bacteria grow, they produce human insulin.
Which choice below is an example of humans modifying the physical environment?
Farmers clearing land to plant
Transportation improvements
Commercial development
Industrial development
What causes this change in fur color?
The two kinds of cells are Prokaryotes and Eukaryotes. How are they
different? *
O Prokaryotes have a nucleus.
OEukaryotes have a nucleus.
O Prokaryotes are plant cells
оThere is no difference.
SOMEONE HELP ME PLZ!!!!!!!!!!!!
How is the energy produced by respiration stored? (Googled answers will be reported) (actual answers please)
Answer: Energy is produced by respiration because its stored within the cells in the form of ATP (Adenosine Triphosphate) .
Explanation:
I'm pretty sure that's it.
- Sorry if I'm wrong :<
Robert Hooke discovered cells in the 18th century.
true or false
Answer:
False it is in the 17th century (1665)
Explanation:
He named the little blocks after cells (little rooms)
Put the boxes in the correct order
Answer:
This was the question you asked earlier and you deleted it after i wrote a whole essay so here. I hope its still of some use.
Explanation:
I believe the most useful ap to use for people of age is Faceb00k. Faceb00k is a safe and friendly app where people can share what there doing or pictures.
So many parents and grandparents use this today to share photos of younger family members, and others can like and comment on there posts. Although their are some who receive hate, most of the people are quite rather friendly.
People like to share there appreciation for l0ved ones by letting the whole world see them through Faceb00k. Most elderly people do this so there younger ones can look back at all the memories they had together. Yes, its true they can just not post it and still look back at memories, but they post it because if it gets deleted and you posted the photos online there will always be a way to recover them.
In conclusion, this is why I believe Faceb00k is the best ap for the more elderly people. Firstly, they can show there memories to the world by showing appreciation. And lastly, whenever you post something online it can always be recovered, so those valuable moments will not be forever lost.
What effect with the enzymes have on the time to make 1 MG of product
Answer:
Decreases
Explanation:
Enzymes speed up chemical reactions so the product is made in less time
A 67-year-old was previously diagnosed with rheumatic heart disease. Tests now reveal lipoprotein deposition with chronic inflammation that impairs blood flow from the left ventricle into the aorta. Which diagnosis does this history support?
Answer:
Aortic stenosis
Explanation:
Aortic stenosis is one of the most common cardiovascular diseases. This disease is caused by the narrowing of the aortic valve opening, thereby restricting blood flow from the left ventricle to the aorta. Symptoms of aortic stenosis include, among others, heart palpitations, swollen feet, chest pain, breathing difficulties, sleeping difficulties, chronic fatigue, etc. Aortic stenosis may be cured by transcatheter aortic valve replacement, which is a minimally invasive surgical technique that allows to replace the narrowed aortic valve.
Which are properties of metals? Check all that apply
Dullness
Malleability
Ductility
Poor conductors of heat
Good conductors of heat
Answer:
2,3, and 5
Explanation:
got it right on edge
Which of the following is an example of evolution that can be studied firsthand by
scientists while it happens (meaning that scientists have opportunities to perform
experiments and to measure the outcome)?
A) The gradual decent of whales from tetrapod (four-legged) land mammal
ancestors
B) A dog shedding its thick winter fur so that it can stay cooler in the summer
C) The acclimation of a person's body to the low oxygen atmosphere at high
altitudes
D) The development of antibiotic resistance in bacteria
Answer:
c.
Explanation:
The acclimation of a persons body to the low oxygen atmosphere at high altitudes
List and describe the different types of connective tissue. What similarities and differences did you observe?
Answer:
There are three types of connective tissues, loose connective tissues, dense, and hyaline.
Explanation:
The difference between them is the composition of the extracellular matrix that surrounds the fibroblast, that is to say that in loose connective tissue, the function will be of support or filling, and the fibroblast is immersed in an extracellular matrix with a high content of water and proteins. collagen.
On the other hand, in dense connective tissue, the amount of collagen fibers is greater, the protein structure as well, and the interlacing between proteins is more complex, and they may also have the ability to calcify as in the case of bone tissue or cartilage.
Finally, we have the hyaline connective tissue, which is very rich in hyaluronic acid and is found in the joints forming the discs, which are shock absorbers and protectors from bone wear due to friction between surfaces, hyaluronic acid, proteinglycans and glycoproteins are the main protagonists of all connective tissues together with the fibroblast, but even more so in the hyaline connective.
Which of the following statements about meiosis is true?
Meiosis creates unique cells.
Meiosis creates identical cells.
Meiosis creates cells such as skin and muscle cells
Meiosis creates glucose in plant cells
Answer:3
Explanation:
In which form food is stored in the leaves? Comment
the answer is starch
Explanation:
food is stored in the leaf in form of starch in plants
The creation of different breeds of dog by humans is an example of...
A) stabilizing selection
B) disruptive selection
C) artificial selection
D) sexual selection
Answer:
I believe it is artificial selection
Explanation:
i learned about this a little while ago lol
This model shows how cold winter air is warmed in the Great Lakes Basin, which creates ideal temperatures for year-round
fruit farming, which statement best describes this interaction?
A)
B)
The biosphere and hydrosphere interact, which affects the
atmosphere
The geosphere and atmosphere interact, which affects the
hydrosphere.
The hydrosphere and atmosphere interact, which affects the
biosphere.
The geosphere and hydrosphere interact, which affects the
atmosphere
C)
D)
Answer: C aka “the hydrosphere and the atmosphere interacts which affects the biosphere“
Explanation:
Hydro means water right... your welcome babes!!!
Spheres are the division of the air, land, water and living organism and their interactions. Interaction of hydrosphere with atmosphere affects the biosphere.
What are the types of the spheres and their relation?The spheres of the air and the constituents of the gases in the planet's surface is called the atmosphere and the water environment and its constituents are called hydrosphere. The sphere where the living organisms resides is called the biosphere.
The air and the air movement of the atmosphere along with the lake conditions or the hydrosphere affects the lives of the organism of the biosphere.
The fruits and the other vegetation is part of the biosphere and gets affected by the air from the atmosphere and the water cycle of the lake from the hydrosphere.
Therefore, option C. interaction of the hydrosphere and atmosphere affects the biosphere.
Learn more about the hydrosphere and biosphere here:
https://brainly.com/question/11591550
Calculate the force needed to cause a 6 kg bowling ball to accelerate 20 m/s2.
Answer:
120N
Explanation:
F=ma
120N=6kg(20m/s^2)
which enzyme attaches the ozaki fragments?
Answer:
DNA ligase,joins the okazaki fragments together into a single DNA molecule
Answer:
DNA ligase attaches the ozaki fragments.
Explanation:
In my thought it's the answer.