Note: Enter your answer and show all the steps that you use to solve this problem in the space provided.

108 is 36% of what number? Write and solve a proportion to solve the problem.

Answers

Answer 1

Answer:

300

Explanation:

108/n = 36/100

36n = 108 x 100 = 10,800

36n/36 = 10,800/36

n = 300.

So, 108 is 36% of 300.


Related Questions

HOLY COW I GOT 1000 POINTS IN ONE DAY

Answers

Answer:

Wow! Congratulations but can you mark me as brainliest? Thanks!

OH WOWW NICE that’s really rad

Which of the following is an issue of food quality rather than food safety?


a prep cook who uses the same cutting board for chicken and salad

a bad odor associated with food

a food handler who did not wash her hands before serving food

food that has been time/temperature abused

Answers

a food handler who did not wash her hands before serving food.

idk what to say so yeah i hope your days going go ig

Answers

Answer:

Great thanks for asking!Wbu

Explanation:

PLEASE HELP! I have 3 questions that need to be answered please help me!!! (and also its my birthday!!!)

1.) what's the definition of transitional light?

2.) what's the definition of Value contrast?

3.) what's the definition of light source?

Answers

Answer:

Happy Birthday

Explanation:

The transition of light is a kind of molecular electronic transition, where electrons in a molecule are excited from one energy level to a higher energy level

2.) Value contrast refers to the amount of contrast between two areas of different value.

3) light source - any device serving as a source of illumination

Happy birthday:)

What do you think the following things are
Atmosphere:
Geosphere:
Biosphere:
Hydrosphere:
Cryosphere:

Answers

Explain so I can try to answer with more accurate explanation.

idk what to say so yeah i hope your days going go ig

Answers

My day is well thank you

Which software application should be used when preparing a budget?

Email
Presentation
Spreadsheet
Word processing

Answers

Of course it is spreadsheet.

Spreadsheet is where you can separate

and build numbers so using that software is

an absolute easy way of building a budget

for a job or anything else. I hope i helped you!

At a restaurant, n cups of tea are made by adding
t tea bags to hot water. If t = n + 2, how many
additional tea bags are ne
needed to make each
additional cup of tea?

Answers

Answer:

1

Explanation:

This is just like a linear equation, since it is a positive number the units are increasing by 1 unit. If we were to plug this into a graph we can see that 2 is the y-intercept which means with 2 tea bags you have 0 cups and for every additional cup of tea you need another teabag, meaning the increase, or slope of the equation so the answer is 1.

Hope this helped :)

Every additional cup of tea requires the use of a new teabag, implying that the slope of equation 1 has increased.

Teabag calculation:

This one is similar to a linear model except that the units increase by one unit because it is a positive integer. When we plot it on a graph, we can see that 2 is the y-intercept. It implies with 2 tea bags, we have 0 teacups and that for every additional cup of tea, we require another tea bag, implying that the rise or slope of the solution is 1.It's a linear equation disguised as a supposedly difficult word problem that asks you to find a slope. The y-intercept is set at 2, implying that 2 teabags equal 0 cups of tea.

Find out more about the teabag here:

brainly.com/question/14922680

What does an accountant do? *
Your answer

Someone please help

Answers

Answer:

An accountant is a professional who is responsible for keeping and interpreting financial records. Most accountants are responsible for a wide range of finance-related tasks, either for individual clients or for larger businesses and organizations employing them.

Explanation:

will anyone be midnight for an rp plz

Answers

Answer:

huhhhhhhhhhhhhhhhhhhhh??????

Answer:

let’s rp

Explanation:

A service station sells gasoline for $3.25 per gallon and diesel fuel for $3.00 per gallon. On Monday, the service station's revenue from selling a total of 131 gallons of gasoline and diesel fuel was $404.25. How many gallons of diesel fuel did the service station sell on Monday?​

Answers

Answer:

7

Explanation:

need explanation too

Answers

Answer:

A) M(x) = 3/2x² - 6

Explanation:

Area of the figure

= Area of the triangle + Area of the rectangle

[tex] = (\frac{1}{2} \times b \times h) + (l \times b)[/tex]

[tex] = ( \frac{1}{2} \times x + 2 \times x) + (x + 2)(x - 3)[/tex]

[tex] = ( \frac{x {}^{2} + 2x }{2}) + (x(x - 3) + 2(x - 3))[/tex]

[tex] = (\frac{ {x}^{2} }{2} + \frac{2x}{2} ) + ( {x}^{2} - 3x + 2x - 6)[/tex]

[tex] = (\frac{ {x}^{2} }{2} + x) + ( {x}^{2} - x - 6)[/tex]

[tex] = \frac{ {x}^{2} }{2} + x + {x}^{2} - x - 6[/tex]

[tex] = ( \frac{ {x}^{2} }{2} + {x}^{2} ) + (x - x) - 6[/tex]

[tex] = ( \frac{ {x}^{2} }{2} + \frac{ {2x}^{2} }{2} ) - 6[/tex]

[tex] = \frac{ {3x}^{2} }{2} - 6[/tex]

[tex] = \frac{3}{2} {x}^{2} - 6[/tex]

please if you don't know don't answer​

Answers

Answer:

Over time tadpoles can grow their tails longer and deeper if there are numerous predators, allowing them to swim faster and look bigger.

(mangrove) Two key adaptations they have are the ability to survive in soaked soil and no oxygen soil, and they have the ability to tolerate slightly salty waters.

Explanation:

I’m looking for remi

Answers

Answer:

youll probably never find her

Explanation:

Answer:

what's remi's username on here? i'll try to find her/him. :)

Thx for the pts, merry christmas, stay safeeeeee!!!!!!!!!!

I want all of you guys that are asking for help to use a calculator like the one that my little sister has in advanced college my dad made me one too Soo just STOP BUGGING THEM and LET THEM DO HOMEWORK INDEPENDENTLY

Answers

Answer:

Why is the point of telling us to use a calculator you're acting like it has every subject in it.

Explanation:

Describe your best friend​

Answers

I wish I could if I even had any friends

Answer: levi form obey me

Explanation:

I love him he’s great he needs his money back from mammon and we can game and watch anime all day it would be nice

How do sperm whales get their food? How does this compare to the spinner dolphins that were shown before?

Answers

They dive down as deep as 3,280 feet in search of squid to eat

journlise the transaction:
goods rs 20000 and furniture of books value 10000 destroyed by fire

Answers

What’s the question though

What is one way that you will use your qualities to help you be successful in life?

- how would i answer this question ?

(this class/subject isnt SAT its called ECLR like a college prep class)

Answers

I would say too get a job and be healthy

A car has a displacement of 160 kilometers to the north in 2 hours.What is its velocity in kilometers per hour please help it's a science question

Answers

Answer:

The velocity of the car is 80kmph towards north.

Explanation:

velocity = distance/time

= 160/2

= 80

The velocity of the car in kilometers per hour given the displacement and the time is 130 kilometers per hour.

What is the velocity?

Velocity can be described as the speed at which a vector is moving in a specifc direction. Velocity is total displacement per time.

Velocity = displacement / time

160 / 2 = 130 kilometers per hour

To learn more about velocity, please check: https://brainly.com/question/18084516

#SPJ2

Other Questions
A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False Right answer will get brainlist pleasee help choose the correct one Which best describes the scene that is described in Countee Cullens Tableau?A. Two children are running away from homeB. A man is remembering his grandfathers table C. A black boy and white boy are walking together as friends D.A black boy and a white body get into a fight on the street . example of secondary analysis Starch is a _____. jhcgrwzxcvhbnkjm