One-eighth of the whole population were colored slaves, not distributed generally over the Union, but localized in the southern part of it. These slaves constituted a peculiar and powerful interest. All knew that this interest was somehow the cause of the war.

–Second inaugural address,
Abraham Lincoln

Which rhetorical appeal is most used in this passage?

pathos
ethos
logos
purpose

Answers

Answer 1

Answer: Pathos

Explanation: Pathos is the rhetorical appeal that uses the creation of emotion as a tool to convince an audience of an idea or viewpoint. Lincoln focused on the fact that the slaves that worked for the Union were color people, and that they were gathered into one particular place. He uses pathos by convincing people that these slaves' powerful and common desire, was the main root of the war.

Answer 2

Answer:

C. Logos

Explanation:


Related Questions

What does the figure above show?​

Answers

Answer: In the image it shows the egg and the larva which is the caterpillar. Then they show the pupa which is called the chrysalis. And BOOM a beatiful  butterfly.

Marking brainliest (easy)

Is my PIQ response good or not? Do I need to make changes?

Answers

Answer:

love it! maybe you should add how important that subject is- mainly so it doesn't repeat itself.

Explanation:

A sentence that has aloof?

Answers

As teenagers, Jaime was easy-going and popular while I was sharp-tougher and more aloof


Hope I helped :))

Should animals be kept as pets by humans? What designates these animals as pets for humans? (Ill give you a brainly)

Answers

I think it's different for everyone and depends on the animals. we are responsible for when they eat drink and urinate so they don't have the freedom of their natural habitats.

point) Who is the "reliable narrator" who tells Montague and his wife how the fray began? a Romeo b Benvolio Tybalt Mercutio d​

Answers

Answer:

The answer is Benvolio

Explanation:

what is the suffix in enclosed​

Answers

Answer:

forclose

Explanation:

The summary or paraphrase should be faithful to the original ideas in the text.

False
True

Answers

The correct answer is true.

What does the metaphor in the sentence below emphasize about the plane?

*The plane slipped through the night, a silvery arrow bursting through the moonlit clouds.*

a. Everyone on the plane is asleep.
b. The plane is painted silver.
c. Moonlight is shining on the plane.
d. The plane is moving quietly at a high
speed.

Answers

Answer:

D

Explanation:

seems to make the most sense

Soul sisters:What events have taken place before the play even begins?

Answers

It is the evening before Dorian's thirty-eighth birthday, and he has dined with Lord Henry.

Who are some of the people, events, new technology, movies, or music that you are familiar with that are about the Cold War, that stand out to you? Why do they stand out to you?

Answers

Answer: The “space race” and the first man on the moon.

Explanation:

The one thing that always amazed me about the Cold War is how it became a great push on the development of space technology. Today it´s very clear that without the competition established between the United States and the Soviet Union during the years of the Cold War, humanity wouldn´t have developed the space travel technology that led to the first landed human on the moon as early as 1969.

The irony of such violent competition based on profound political confrontation having such a positive outcome is always the first thing that comes to mind when thinking about the Cold War.

Use fawning in a sentence

Answers

Hopes this helps:

Answer: Jessi wasn’t certain if she should be laughing or horrified by the fawning women.

Help me please!!!!!!!

Answers

I have a feeling it d

how does each fable develop the topic of greed? mostly from the story "The dog and his reflection and "The swollen fox"

Answers

Explanation:

In the case of the fable of "The dog and its reflection"; , for not being happy with the bone he had and wishing for another bone that "seemed bigger" but was actually an illusion, the dog was left without a bone, the lesson he leaves us is that we have to be grateful and be happy with what we have.

In the case of "The swollen fox"; we can see that by wanting to eat everything quickly due to the hunger he had, he filled up very quickly and was trapped, this teaches us that we must take things slowly and if we want to be successful in whatever we do, no We must be greedy because the consequences will not be very good for us,

Finally, in the fable of the swollen fox we can also learn a lesson about patience, as the fox was trapped now he had to be patient and wait until his belly deflated to get out; In the same way, if we have difficulties or very hard trials in our lives, we must be patient, because patience helps us calmly endure difficulties and not despair; there will always be a solution for everything!

The FAFSA4caster is a:
O A. predictor of a student's college graduation date.
B. free online financial aid estimator tool.
C. low-interest student loan.
D. predictor of college success.

Answers

Answer: free online financial aid to estimator tool

Explanation:

The growing recognition of the importance of equity, diversity, and inclusion in the workforce has led to legislation requiring employers to ensure that workplaces are free from discrimination. How would you know if an employer has met this responsibility? Why would this be important to you?

Answers

Answer:

Why is Responsibility important in the workplace? Responsibility drives business results. Responsible workers are more engaged and hold themselves accountable to deliver results. Responsible leaders create environments which cultivate high performance teams which in turn deliver business results.

Explanation:

Risk assessments should be carried out that address all risks that might cause harm in your workplace. Employers must give you information about the risks in your workplace and how you are protected, also instruct and train you on how to deal with the risks. Employers must consult employees on health and safety issues.

Hi! Can someone help me describe a Baseball, Like the ball it's self. I am working on a descriptive writing (The ball).

I just need a simple description of the ball used in base ball. ​

Answers

uhh you can describe it as a hard round ball

3. Which of the following best describes the evolution of Jacques
Lacan's concept of the mirror stage?
O A Lacan changes the ages of the infantile mirror stage from 15-
18 months to 6-18 months, allowing for a larger age range
when babies can recognize their reflections.
OB Lacan calls the mirror stage as a phenomenon but later
labels it as a general part of normal human (and chimpanzee)
development.
OC Lacan's theory becomes more abstract, the concept taking
on a more philosophical tone than a scientific one.
OD Lacan alters his concept so that it is not considered just a
small period of an infant's life, but an essential and lasting
element of a person's identity.

Answers

Answer: D

Explanation: honestly i’m doing this rn and i think this is the best answer. let me know if it isn’t though.

Which best explains the definition of stream of consciousness?
A. Narration that tries to imitate the patterns of real thought
B. Narration that includes every detail the writer thinks of
C. Narration that focuses on external appearances
D. Narration that is written quickly and left unedited​

Answers

I’m going to say B or D. Hope I’m right
Hopefully this helps:)

create a unique pun,but you explain why you selected it​

Answers

Why were the teacher’s eyes crossed? Because she couldn’t control her pupils.
I selected this pun because it makes sense and it made me laugh and a pun is to put something together to make it funny thats what a pun does

How does Mr. Frank use what he thinks about his daughter to comfort her?

Answers

Answer:

the book?

Explanation:

1.
Luis was so scared when he went into the haunted house. He felt
as if any second the madman with the chain saw was going to cut his foot off. He
tried to stay away, but each time he cringed the madman got closer. It was very
scary
The tree at Doctorfollan contoh
THI

Answers

where's the question???

Both “The Masque of the Red Death” and “Young Goodman Brown” can be seen as allegories, or stories that use characters and plot as symbols for larger ideas about the nature of humanity. How are these stories alike and different? You might consider the stories’ symbols, settings, characters, use of language, the authors’ attitudes toward their characters and events, and so on. What larger idea about the nature of humanity does each present? Support your writing with evidence from the text.

Answers

Please post a picture of the story so i can help you.

Much historical controversy surrounds death of Alexander the great.. Some belief that he died of alcohol poisoning, while others belief that he was poisoned by won of his Generals, who had much to gain form his death.
Which rewrite of the passage corrects the most errors in spelling and grammar?


A.
Much historical controversy surrounds death of Alexander the great. Some believe that he died of alcohol poisoning, while others believe that he was poisoned by one of his Generals, who had much to gain from his death.

B.
Much historical controversy surrounds the death of Alexander the Great. Some belief that he died of alcohol poisoning, while others belief that he was poisoned by one of his generals, who had much to gain from his death.

C.
Much historical controversy surrounds death of Alexander the Great. Some believe that he died of alcohol poisoning, while others believe that he was poisoned by won of his generals, who had much to gain form his death.

D.
Much historical controversy surrounds the death of Alexander the Great. Some believe that he died of alcohol poisoning, while others believe that he was poisoned by one of his generals, who had much to gain from his death.

Answers

It’s d the g in great of Alexander the Great should be capitalized

The passage that corrects the errors in spelling and grammar is option (D). Thus the correct option is (D).

Who was alexander the great?

Alexander was the ruler of Macedonia who established the largest empire in the ancient history. The was the great military general who extended his empire from Egypt to Greece and some parts of ancient India.

The correct passage is - Much historical controversy surrounds the death of the Alexander the Great. some believe that he died of alcohol poisoning, while others believe that he was poisoned by one of his generals, who had much to gain from his death.

Thus the option (D) is correct.

Learn more about Alexander here:

https://brainly.com/question/1286645

#SPJ2

Can someone please correct me or tell me if I’m correct please the passage is not necessary it’s just in your own thoughts thank you

Answers

Answer: The correct answer is D.

Explanation: The other three options can all be taken as objective, meaning they aren't coming from someone's opinion and are instead statements of record. With option D, the person is telling us they believe something to be of importance. This is clearly an opinion, and not a historical account.

Select two sets of lines that support the inference that the girls are still
innocent and naive.
"I see them always there,
Upon the low, smooth wall before the church;" (lines 9-10)
car,
"Sometimes by twos and threes, sometimes as many as five
But always they sit there on the narrow coping(lines 15-16)
"Bright-eyed and solemn, scarcely hoping
To see more than what is merely moving and alive." (lines 17-18)
"Before the quiet church...
They sit." (lines 21-22)
my as five
"They tremble to but cannot understand.
It thrills and troubles them, as one by one, (lines 27-28)
e.

Answers

Answer: C and E

Explanation:

How can you identify a subject in a sentence?​

Answers

Answer:

The subject of a sentence is the person, place, thing, or idea that is doing or being something. You can find the subject of a sentence if you can find the verb. Ask the question, "Who or what 'verbs' or 'verbed'?" and the answer to that question is the subject.

Explanation:

By the Waters of Babylon
What is the name of the narrator of the story? How do you know

Answers

John is the narrator I know because he uses “I” so it’s pretty obvious (hope this helps)

When he was liberated, the author's main thoughts were
about his family and getting revenge for their deaths.

True
False

Answers

true, but i’m not totally sure

Why do I keep getting links for answers are they viruses are actual answers?

Answers

Answer:

bcuz these f..king people luuuv to ruin lives

they hck u

it aint a virus

im experienced

For future i hope u dont get any links ever again:))

Explanation:

Answer:

they virusis. i hate it when your just trying to figure out an wser then these bots just place a link so they can hack and steal your ip adress and steal all your money

Explanation:

The poet says "Yet knowing how way leads on to way, / I doubted if I should ever come back." What does he mean by "how way leads on to way"?

Answers

Answer:

In these lines, Frost is referring to choice. Once a person has decided on a particular route, it is doubtful whether one would ever have the opportunity to return to the original choice and thus decide again.

Other Questions
which system supports sales forecasting? a. personnel information systems b. marketing information systems c. financial information systems d. logistics information systems A playground is in the shape of a rectangle. The length of the rectangle is three times its width. The area of the playground is 19,500 square feet. What is the length of the playground? Round to the nearest foot. Hint: use A=LW Please write in the correct adjective.1. Mi hermano es __________(fat).2. Mis abuelos son _______(strong). 3. La hija es muy _______ (pretty).4. Mi esposo y yo somos ___________ (smart).5. Yo soy ______________ (burnette).6. Yo estoy ____________(busy).7. Nosotras estamos __________(sad). In the figure below, R is between Q and S, and S is between R and T. If QS = 12, RT=9, and QT=17, find RS. Name the main layers of a tropical rain forest. What kinds of plants grow in eachlayer? Please select the word from the list that best fits the definitionIllegitimate power that is achieved by force or the threat of force. Describe and correct the error in solving the equation This bar chart shows the numbers of pets owned by peoplequestioned in a survey. Note that the scale on the verticalaxis is missing.The total number of petsowned by the respondentsis 92.How many people ownedexactly 2 pets? Why did many americans lose faith in president ford's leadership during his first months in office? How empathy can be used to build positive relationships? CALLIn this cartoon, how are the eastern and western sections of the United Statesdivided?OA. They are divided between states that allowed women to vote andthose that did not.B. They are divided between states that voted Democratic andRepublican.OC. They are divided between slave and free states.OD. They are divided between states that passed the ThirteenthAmendment and those that rejected it. What is the meaning of vadya? Multiply. State the product in simplest form..p-4p-1218p6p+12 p-9p+18, p - 2,3,6 How many years should I pay for SSS? What were the 3 Populist Party beliefs? The five-factor model of personality:is supported by the results of projective tests.is supported by genetic markers.has proven useful across the life span in many cultures.is not well supported. Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 0.000 $20.000 530 000 S40 Task Instructions x Honolulu Denver Add the alternative text Cost forecast for three years and four cities to the chart. 1:35 AM 4 4U 325/2020 100% ^ (1) ENG 1:35 AM 11/30/2020 AUSWADUI LUULEL Attempts Remaining 7 Submit PB Forecast Excel Sign in File Home Insert Page Layout Formulas Data Review View Tell me what you want to do Askar Com General 28 O IU Insert Delete Format 14 29 Wrap Test B.O.A. s E Merge Center Alge > Cost Forecasts by City - Kitchens $ . % 4 Conditional Formatas Call Formatting Tata Styles Norber - Autocom - COR Sortid Clear Filter Set Editing board Font H M O Precision Building Cost Forecast by City Cost Forecasts by City - Kitchens City Year 2020 Year 2021 Year 2022 $43.000 $44000 $45,000 550.000 $65.000 $67.000 $38.000 $40 000 $43.000 $5.500 $55.000$$7.500 Atlanta, GA Boston, MA Denver CO Fionolulu, HI 2011 Based on 150 sq. ft. Kitchen S. . 50 Honolulu Denver Task Instructions Forecasts Add the alternative text Cost forecast for three yem and four cities to the chant. Type here to search i 1252 O DI How can I get my SSS verification slip online? What were the goals of the US in Afghanistan?