Plz Answer ASAP! Thank you!
Write a fictional narrative about a character who struggles to communicate with another character. Think about why they might need to communicate and consider events or actions that may lead up to their discovery of effective communication.


Exposition:

✓ What is the setting?

✓ Who are the main characters?

✓ How will you develop them?

✓ What point of view will you use?

✓ What is the main problem, or conflict?


Rising Action, Climax, Falling Action:

✓ What events will you include in the rising action?

✓ What is the climax?

✓ How will the character(s) work to resolve the conflict?​


Resolution:

✓ How will the conflict be resolved?​

✓ How will the characters respond to this resolution?​

Answers

Answer 1

Answer:

So you want us to give you a character that's mute?

Explanation:

Answer 2

Dialogue is the spoken exchange of information between at least two characters, usually spoken aloud. There are instances when a character's mind and body can speak to one another.

What is information?

Information is a general term for everything with the capacity to inform. Information is most fundamentally concerned with the interpretation of what may be sensed. Any naturally occurring process that is not entirely random, as well as any discernible pattern in any medium, can be said to convey some level of information.

A fictional narrative is a tale you make up in your head. To control the course of the story, you must select your characters and exercise creative imagination. The story must be made relatable to your audience in order for them to believe it.

In a nutshell, fictional narrative writing tells a made-up tale. The three most crucial components of a fictional narrative story are 1) A clear storyline, credible characters, and an interesting setting. 2) A coherent series of crucial moments followed by a conclusion (usually 3-5 paragraphs long in all).

Therefore, The oral communication between two or more pieces of information,

Learn more about the information here:

https://brainly.com/question/13629038

#SPJ2


Related Questions

how many super bowls have the green bay packers won

Answers

They have won 4 times

Think about the image above. What is happening in it? In the space below, explore your thoughts about the meaning of the image.

Answers

I think what's happening in the image is two different sides of the person

How significant is the development of your brain to who you are? How permanent is it to who you are? Does it change dramatically with the development of your brain?

Answers

Answer:

Practice makes permanent, and that goes for brain function, too. "You can't improve memory if you don't work at it," says Dr. Morris. "The more time you devote to engaging your brain, the more it benefits." Your activity should require some level of constant practice, but the goal is not to strive for vast improvements.

Explanation:

Which sentence shows correct use of parallelism?

•Jonah likes to play soccer, to go swimming, and riding his bike.
•Jamie is smart, funny, and she has a nice personality.
• James likes reading, writing, and watching movies.

Answers

Answer:

• James likes reading, writing, and watching movies.

Explanation:

What is the significance of globalization (e.g., magnitude, impacts, etc.)?
Most importantly, what may globalization mean to you and others you know, (i.e., how might it impact your future in terms of your career and quality of life?)

Answers

Answer:

Globalization changes the way nations, businesses and people interact. Specifically, it changes the nature of economic activity among nations, expanding trade, opening global supply chains and providing access to natural resources and labor markets.Globalization changes the way nations, businesses and people interact. Specifically, it changes the nature of economic activity among nations, expanding trade, opening global supply chains and providing access to natural resources and labor markets. ... Increased trade promotes international competition.

Even though the pizza was too to eat, we ate it anyway

Answers

Even though the pizza was too hot to eat, we ate it anyway.

Even though the pizza was to hot to eat we still ate is anyway.

Read the passage. The Ride of His Life When Jesse Senko was 12 years old, he had an experience that literally changed his life. Senko was snorkeling while on vacation in the Cayman Islands with his family when a large sea turtle swam near him. Senko naturally did what any 12-year-old boy would do and decided to grab the turtle and go for a ride. That turtle ride, in some ways, has never ended. People find their passions in many different ways. Senko found his passion while riding on the back of a turtle when he was just 12 years old. Today, Senko is a conservation scientist at Arizona State University. He focuses his research and life’s work on marine resource sustainability. Can you guess what that includes? If you guessed sea turtles, you would be correct. In college, Senko majored in fisheries and wildlife science, and he also received a Master of Science degree in wildlife ecology. Much of the focus of his work is on saving endangered sea turtles. Sea turtles help keep the ocean healthy, and thus their well-being affects the entire ecosystem. They provide a natural regulatory system for the environment. For example, sea turtles eat seagrass, which helps it grow properly, and their unhatched eggs provide nutrients for plant life to keep beaches healthy. Sea turtles also provide a home for small animals that attach to their shells. Sea turtles are endangered because fishermen inadvertently catch them in their nets, which can cause the turtles irreparable harm. Senko came up with the idea to create solar-powered fishing nets so fishermen can readily see when they accidentally catch a sea turtle. Because the lights are solar powered, the fishermen do not have to maintain the lights or change the batteries. This technology has resulted in a 65 percent reduction in sea turtle catches thus far. Senko’s goal is a 100 percent reduction.
Question 1 Part A What is a central idea of "The Ride of His Life"?
Solar power is essential to saving sea turtles.
Sea turtles are the most endangered animals in the ocean.
Sea turtles are a critical part of the marine ecosystem.
Modern technology such as solar nets will help save the environment.
Part B

Which sentence from the text best shows the development of the central idea in Part A?


"Today, Senko is a conservation scientist at Arizona State University. He focuses his research and life’s work on marine resource sustainability."

"Sea turtles are endangered because fishermen inadvertently catch them in their nets, which can cause the turtles irreparable harm."

"…sea turtles eat seagrass, which helps it grow properly, and their unhatched eggs provide nutrients for plant life to keep beaches healthy."

"This technology has resulted in a 65 percent reduction in sea turtle catches thus far."

Answers

Answer:

Part A- Sea turtles are a critical part of the marine ecosystem.

Part B- "…sea turtles eat seagrass, which helps it grow properly, and their unhatched eggs provide nutrients for plant life to keep beaches healthy."

Explanation:

Read the excerpt from "A Genetics of Justice" by Julia Alvarez. By the time my mother married my father, however, she knew all about the true nature of the dictatorship. Thousands had lost their lives in failed attempts to return the country to democracy. Family friends, whom she had assumed had dropped away of their own accord, turned out to have been disappeared. My father had been lucky. As a young man, he had narrowly escaped to Canada after the plot he had participated in as a student failed. This was to be the first of two escapes. That same year, 1937, El Generalísimo ordered the overnight slaughter of some eighteen thousand Haitians, who had come across the border to work on sugarcane plantations for slave wages. What is the central idea of this excerpt? The dictatorship resulted in many deaths. It was possible for people to escape to Canada. Many people fought for a democratic nation. The author’s family was unusually lucky.

Answers

The central idea of this excerpt is:

The dictatorship resulted in many deaths.

Let's understand why the above option is the correct answer.

From the excerpt, the author revealed that thousands actually lost their lives. This plainly shows that there were many deaths.

Here is a textual evidence: "Thousands had lost their lives in failed attempts to return the country to democracy."

Also, the author stated that about eighteen thousand Haitians were slaughtered overnight by the order of the General.

Thus, the central idea of the passage shows that the dictatorship resulted to many deaths.

Learn more about dictatorship on https://brainly.com/question/14412840

Answer:

answer is A

Explanation:

just finished the quiz with 100%

a higher proportion of unemployed adults lived in food insecure households meaning

Answers

Answer:

"The condition of not having access to sufficient food, or food of an adequate quality, to meet one's basic needs."

Explanation:

Food insecurity definition

edgar allan poe died in 1849. what is going on in dickens’ life at that time?

Answers

Answer:

i dont know

Explanation:

What revision, if any, is needed to make this thesis statement more effective?


In the novel Lord of the Flies, William Golding uses Ralph, with his leadership, initial optimism, and naivete, as a symbol for order and civilization.


a) It needs to address meaning, or the "so what?"

b) It needs to be arguable or defensible.

c) It should provide evidence for the position.

d) It should provide the last names of characters.

e) No revision is needed; the thesis is effective.

Answers

In order for the thesis statement to be more effective, it must be arguable or defensible.

A strong thesis statement provides direction to the essay or paper and creates a focus or limits the scope of the subject. It also provides the readers with information about what the body of the thesis is all about.

What are the qualities of an effective thesis statement?

Below are qualities of a good/effective thesis statement:

It must be argumentative. A statement of fact such as "all automobiles require an engine" is a statement of fact that cannot be refuted, hence,  an ineffective thesis statement.

Specificity. Broad is not good. Focused and specific is great.

Engaging. A provocative or interesting statement always trumps a bland one. The thesis statement is supposed to serve as a hook that draws the reader into your thoughts.

The correct answer, therefore, is B.

See more about Effective Thesis Statements in the link below:

https://brainly.com/question/12946687

Karen Carpenter is famous __________ the song Top of the world.
A. for B. of C. in D. up

Answers

Answer:

the answer is probably D

We the People of the United States, in order to form a more perfect Union, establish Justice, We the people of the United States, in order to form a more perfect union, establish justice, insure domestic Tranquility, provide for the common defense, promote the general
Welfare, and secure the Blessings of Liberty to ourselves and our Posterity, do ordain and establish this Constitution for the United States of America.

In three to five sentences, explain the significance of capitalizing the word "Posterity" in the Preamble.

Answers

Answer:

Our Prosperity refers to the children and descendants of the writers of the Constitution. They wanted to emphasize that Prosperity was the Americans who through the coming years would benefit from the Constitution.

Explanation:

hope this helps

Answer my question plzzz!!
What is the theme?
AND!
What is the topic and the message of the story?

You Have to answer both questions!!!

Answers

Answer:

Theme: Listen to warning signs (or something of the sort, like: be more cautious about online advertisements)

The topic is about learning to be cautious about internet advertisements, even if you want what they might be offering it's better to get that item legitimately.

Message is just overall be careful with what you put trust in and be more cautious about things being promised on the internet.

(Hope this helps ^w^ I'm new to answering questions, sorry)

Explanation:

Which organisms occupy two different places within the same food chain? (Select all that apply.)
thermophiles
remora
pitcher plant
Venus flytrap

Answers

Considering the available options, the organisms that could occupy two different places within the same food chain are remora, pitcher plant, and Venus flytrap.

What is Food Chain?

Food Chain is the straight web of links in a food network beginning from producer organisms and stopping at top predator animals, detritivores, or decomposer organisms.

In this case, remora is a predatory fish and can also be eaten by higher animals like bigger fish or crocodiles.

Also, the pitcher plant is a carnivorous plant that can trap and consume small animals and, at the same time, can be consumed by more giant animals.

Similarly, the Venus flytrap is a plant that can trap and consume small animals while being eaten by bigger animals.

Hence, in this case, it is concluded that the correct answer is options B, C, and D.

Learn more about Food Chain here: https://brainly.com/question/16504883

Answer:

The answer is pitcher plants and remora

Explanation:

Read the excerpt from Gilgamesh: A New English Version. "Let your heart inspire you to be joyous in battle, to forget about death. If we help each other and fight side by side, we will make a lasting name for ourselves, we will stamp our fame on men's minds forever. " Which sentence best states the theme of the excerpt? Gilgamesh ignores the threat of death. People's actions determine their legacy. Fighting for one's country is important. With reassurance, Enkidu prevails.

Answers

The corrective and the most suitable statement from the given phrase will that the Gilgamesh forget the Threat of the death and they want every soldier to enjoy the war .

The Gilgamesh  was the great king for their people and for their soldiers, he want to protect them at any cost . Gilgamesh  was in search of immortal and want to remove the fear of war from the heart of the soldiers.

The Gilgamesh  as also consider as the half god as his other was belongs to gods, and he was so powerful that he had no fear of war and also ready to fight with the big countries.

For more information on Gilgamesh , please refer the below link :

https://brainly.com/question/16553774

Answer:

the answer is b i just took the test

Explanation:

What big change is taking place in the lives of these characters

Answers

Answer:

what characters

Explanation:

Which of the following forms of rhetoric are consistent patterns that help the reader make associations with other elements? Select all that apply.

diction
repetition
allusion
parallelism

please help me will give 30 points to correct answer

Answers

Allusion

Allusion is a figure of speech, in which an object or circumstance from unrelated context is referred to covertly or indirectly
Allusion because yea and yea

Write an essay responding to the following prompt: Who do you think is the tragic hero - Caesar or Brutus - in Shakespeare's play Julius Caesar? Why?
HELP ASAP! Due today!!!
Giving the crown
No spam!!

Answers

Answer:

A tragic hero as a character of amazing reputation and prosperity and their misfortune is not because to depravity or vice, while the hero is a virtuous character but to an error in judgment resulting from a tragic flaw. Sometimes this flaw is an excess of virtue. In The e of Julius Caesar by William Shakespeare, the perfect tragic hero being Julius Caesar or Marcus Brutus.ia debatable. They both fit the criteria of a tragic hero, but Marcus Brutus proves to be the better and more fit of the two.

Explanation:

Both Caesar and Brutus have vast prosperity. Caesar earned his by being such a great general and a leader proving his power and might. Brutus also has great prosperity like Caesar. And, the last eulogy was given to Brutus not Caesar, which implies that Brutus is the hero because the last eulogy is usually saved for the tragic hero at the end of the play.

William Shakespeare's play, Julius Caesar, presents a complicated trap of characters ensnared in political disturbance and moral quandaries. Inside this embroidery, two conspicuous figures arise as possible unfortunate legends: Julius Caesar, the aggressive pioneer, and Marcus Brutus, the respectable plotter.

Julius Caesar has a few characteristics that line up with the old style qualities of a heartbreaking legend. His outstanding initiative, desire, and compelling persona make him a focal figure in the play. Caesar's ascent to control, set apart by military victories and public idolization, embodies the characteristics of a remarkable person.

His exorbitant pride, be that as it may, fills in as the establishment for his lamentable defeat. Overlooking the admonitions and feelings that encompass him, Caesar ignores the chance of his death, exhibiting an absence of mindfulness and weak spot.

Learn more about Julius Caesar, from:

brainly.com/question/30160306

#SPJ2

Read the excerpt from "Music Gets Personal.” Radios had to be made and sold. Radio stations had to be built, too. All of this took more time. Finally, in the 1920s, music recording and radio came together. People listened to music in their homes. They bought record players. They listened to music on the radio, too. What is the best summary of this excerpt?

Many people held jobs making and selling radios and building radio stations and record players.

Families enjoyed listening to music and other shows that were broadcast on the radio.

In the 1920s people became interested in purchasing records so they could play them on their record players.

Radio created a music industry, and by the 1920s people began enjoying music at home.

Answers

Answer:

Radio created a music industry, and by the 1920s people began enjoying music at home.

Explanation:

The excerpt seems to be focusing on this statement through, "People listened to music in their homes. They bought record players. They listened to music on the radio, too." Secoundly, the title of "Music Gets Personal" provides the idea that the rest of the excerpt may be about people being able to become closer to music.

1. Explain the definitions of the four income groups.
2. Identify two countries within each of the four income categories
3. Why do you think the U.S. is one of the few countries to fall within the high-income category?
4. Compare poverty in the U.S. to poverty in low-income economies.

Answers

Based on the World Bank definition, the four income groups are the groups in which various countries are categorized based on how their economic growth, inflation, exchange rates, and population growth influence GNI per capita.

2. The two countries within each of the four income categories are:

Low-income groupAfghanistanBangladesh

Lower-middle income groupBeninTajikistan

Upper-middle income group BrazilMauritius

High-income countries income groupUnited StatesSwitzerland

3. Typically, the U.S. is one of the few countries to fall within the high-income category because they have good economic growth, lower inflation rates, favorable exchange rates, and adequate population growth that positively impact their GNI per capita.

4. When comparing poverty in the U.S. to poverty in low-income economies, it is always concluded that poverty in the United States is less extreme.

There is no extensive famine and drastic stunting of children in the US, unlike low-income countries.

Hence, in this case, it is concluded that Income groups are one of the ways to categorize the countries of the world based on socio-economic statistics.

Learn more about Income Groups here: https://brainly.com/question/25221038

A lead ball is dropped into a lake. The ball begins
to sink to the bottom of the lake. What force is causing
the ball to sink?

A. Buoyancy
B. Gravity
C. Lift
D. Thrust

Answers

Answer:

B. Gravity (would be reasonable)

C. Lift (that doesn't make sense)

A. Buoyancy (means float)

D. Thrust (means to push through)

Explanation:

The correct one is most likely gravity.

Once a farmer has planted root crops in a field, what should he or she grow the following year in that same field?​

Answers

Answer:

Crop rotation is the practice of planting different crops sequentially on the same plot of land to improve soil health, optimize nutrients in the soil, and combat pest and weed pressure. For example, say a farmer has planted a field of corn. When the corn harvest is finished, he might plant beans, since corn consumes a lot of nitrogen and beans ...

Explanation:

For this journal write 1 page on what you think the themes of this time of year are, and how they reflect in the stories we hear. Pick one story in particular and how you think it specifically represents this time of year and the themes around the winter season.

Answers

The following are tips concerning the themes of this time of year and how they reflect in the stories we hear:

This time of year (winter and Christmas time) tend to remind us of themes such as gratitude, solidarity, and love. One example of how that influences stories is the fact that Christmas/winter movies, tales, and even news tend to be about those themes.You can choose a story from a movie, or a famous tale such as "A Christmas Carol" to better develop an analysis of its theme. You can also choose a real-life story, maybe a piece of news about people who help the homeless during winter.

A theme is the main idea present in a literary work. It is the message, the lesson, or simply the subject of the story.

When we pay attention to Christmas/winter time stories, we notice they have some common themes, such as gratitude, solidarity, or love.

Most stories seem to be about reuniting with one's family, or helping others during a difficult time, or simply about realizing how one should be grateful for everything one has.

Even news reflect such themes during winter. It is common to hear or watch news about people giving away food, clothes, or even a shelter to those in need.

Learn more about theme here:

https://brainly.com/question/1673952

What does Trini do as the clock winds down?

Answers

Answer:

It’s 12 o’clock

Explanation:

story locklocklocklock

For the tree decorating contest, you must FACTOR in the MULTIPLE possibilities for a PRIME tree that is decorated in central SQUARE. ADD some lights and you have PATTERNS of beautiful trees among the delicate snowflakes.





keyboard

Enter Your Combination









Answers

Answer: The word whose BOLD part is pronounced differently from the other three in each question.

1. A. writes B. makes C. takes D. drives

Writes

2. A. boring B. choir C. sporty D. more

Choir

3. A. climb B. balcony C. club D. barbecue

Climb

What is the “herd instinct”? According to de Waal, what might be a potential downside to this part of human nature?

Answers

Human herd behavior can be observed at large-scale demonstrations, riots, strikes, religious gatherings, sports events, and outbreaks of mob violence. When herd behavior sets in, an individual person's judgment and opinion- forming process shut down as he or she automatically follows the group's movement and behavior.

"i'm the oldest man in the village" Name the village mentioned here?



answer me fastly please.​

Answers

Answer:

oldest man

Explanation:

BRAINLIEST PLEASE

CARRY ON LEARNING

Why does Long use colloquial language?(every man a king)
O A. To seem more relatable to his audience
O B. To highlight the complexity of the topic at hand
C. To sound more educated than he actually is
D. To distinguish himself from his listeners

Answers

Answer:

B) To highlight the complexity of the topic at hand

Explanation:

He used the lectures to criticize the concentration of riches in the hands of a few individuals and to emphasize the hardship of the man poor in his own state, a populist politician. A portion of the "every man is a king" speech read.

Answer:

A

Explanation:

I don't think the other guy even knows what colloquial language is lol. Colloquial language is when you talk and use words that are used in a certain place and time. For example, "I'm cranking 90's Morty!" Is an example of colloquial language. If you don't know the terminology, you won't get what Rick is saying. But if you know what cranking 90s means, then you can relate to and understand this quote.

Which describes a verb tense shift? a verb tense changes a verb tense is irregular a verb tense is spelled wrong a verb tense stays the same

Answers

Answer:

a verb tense changes

Explanation:

an example:

I went to the store, and I buy some apples.

                                     bought

Other Questions
Which statement best explains how the animals in the diagram contribute to the carbon cycle?AThey eat plants and other organisms that contain carbon which prevents it fromever being Stored.BThey eat plants and other organisms which contain carbon and deposit carboninto the soil when they die.They remove carbon from the atmosphere during respiration and replace it withoxygen that is used in photosynthesis.DThey remove carbon from the soil during respiration and exchange it withoxygen that evaporates into the atmosphere. Which of the following goals is NOT a focus of typical community health promotion efforts? A. Lower prescription costs B. Long-term health C. Disease prevention D. Senior citizen health Please select the best answer from the choices provided. A B C D. Lyssa and Carlos own a hardware store. They sell a certain type of light bulb in packages that each contain 24 bulbs. The back of each package says, " The expected number of broken or defective packages per bulb is 0.25" Lyssa says, "If we look at 100 packages, we expect to see a total of about 250 broken or defectve bulbs" Carlos says, "Any given package most likely contains 0.25 broken or defective bulbs".Which Statement is correct based on the expected value?A. Only LyssaB. Only CarlosC. Both Statements are correct. D. Neither Statement is correct. Marko is playing the video game fort attack. The purpose of the game is to shoot invading bandits that are trying to breach the fort's circular wall, and marko must provide the angle at which the cannon should turn in order to shoot the attacking bandits. The bandit is attacking as pictured in the figure below:. Who is Francois Mauriac and why, according to the Preface/Foreword, does he help Wieselget published? How does Mauriac describe Wiesel? Use textual evidence to support youranswer:I a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade.