To whom is Lamartine referring when he writes “the multitude” in History of the French Revolution of 1848

Answers

Answer 1

Answer:

Answer:

Explanation:

Answer:

Explanation:

Answer:

Explanation:

Explanation:

To whom is Lamartine Answer:

Explanation:

Answer:

Explanation:

eferring when he writes “the multitude” in History of the French Revolution of 1848

To whom is Lamartine referring when he writes “the multitude” in History of the French Revolution of 1848

To whom is Lamartine referring when he writes “the multitude” in History of the French Revolution of 1848

To whom is Lamartine referring when he writes “the multitude” in History of the French Revolution of 1848

To whom is Lamartine referriAnswer:

Explanation:

ng when he writes “the multitude” in History of the French Revolution of 1848

To whom is Lamartine referring when he writes “the multitude” in History of the French Revolution of 1848

To whom is Lamartine referring when he writes “the multitude” in History of the French Revolution of 1848

To Whom Is Lamartine Referring When He Writes The Multitude In History Of The French Revolution Of 1848

Related Questions

Write: What does the author mean when he says that the
Europeans saw their invasion of Africa as a "civilizing mission"?

Answers

The idea is that European thought of themselves as superior (Charles Darwin theory strongly supported it) and that it is their duty to spread civilization to different parts of the world, hence the so-called “civilizing mission” when they decided to colonize Africa in the 19th century.

Why were some Americans Anti-Imperialists in the late 19th and early 20th Century?

Answers

The anti-imperialists opposed expansion, believing that imperialism violated the fundamental principle that just republican government must derive from "consent of the governed." The League argued that such activity would necessitate the abandonment of American ideals of self-government and non-intervention—ideals

American factories are making more than the American people can use; American soil is producing more than they can consume. Fate has written our policy for us; the trade of the world must and shall be ours

According to the document, what was one effect of industrialization in the United States?

A.Factories and Farmers were producing more goods and crops than Americans could consume
B.Overcrowding in cities
C.Low wages for factory workers

Answers

Answer:

A

Explanation:

The article seems to be talking about the american farmers and factories producing surplus of goods.

Which countries lagged far behind in industrial development because of their
geography?

A. France and United States

B.Belgium and Great Britain

C.Austria-Hungary and Spain

D. Germany and Piedmont-Sardinia

Answer:

Answers

Answer : B - Austria - Hungary and Spain

Explanation : If you think my answer is good give me 'Brainliest'or rate/heart my answer.

Answer:

Answer:A.France and United States

Liked my answer and make me brainliest if it is correct

How has the Russian Revolution impacted the world today? Which nations are the most impacted? What would those nations be like if this revolution hadn't taken place? Be thorough and explain why this was such a significant part of history!

Answers

Answer:

the Russian revaluation caused the cold war

Explanation:

if the revaluation hadn't happened Russia never woulda became communist

The idea that Americans had a God-given right to expand westward was known as..

Answers

Answer:

Manifest Destiny

Explanation:

Manifest Destiny was a popular belief in the mid-to-late 19th century. Its proponents claimed that the United States had the divine right to expand westward—meaning that U.S. expansion was the will of God.
Manifest destiny why well because it is

how did the Meredith March Against Fear reveal splits in the Civil rights Movement

Answers

Answer:

on June 5th 1966 james meredith who had integrated the university of Mississipi in 1962 began the march against fear

Explanation:

How did the election of 1800 influence American democracy?

A. It forced the losing party to agree to everything that the winning party wanted.
B. It established that enslaved people would count as part of a state's voting population.
C. It gave the Senate the power to choose the president in the event that two candidates tie.
D. It set a precedent for a peaceful transfer of power between two presidents of different political parties.

Answers

Answer:

I think A

Explanation:

This election of 1800 was an important turning point in American history because at the time the Federalists controlled the army the presidency and Congress they could've refused to step down and overthrown the Constitution.

Answer:It set a precedent for a peaceful transfer of power between two presidents of different political parties.

Explanation:

i hope this helps:)

how many battleships were destroyed at pearl harbor

Answers

Answer:

8 battleships

Explanation:

chronological order.
Arrange the events in

Answers

Answer:

Chronological order is the order in which the events occurred, from first to last also known as order of the time/year

Explanation:

Give a suitable title for the graph.

Answers

choose a name that suits what you are doing the graph about
for example a name could be ‘how long it took the ice to melt’ if it was about an ice cube melting

Select the statements accurately describing the advantages of having whole life insurance coverage versus carrying term life
insurance coverage.
es )
A)
Whole life insurance is substantially less expensive than term life
insurance
Whole life insurance coverage usually lasts for policyholder's entire
lifetime.
B)
C)
Whole life policies usually last for increments of ten, twenty, or thirty
years.
All whole life policies are available to anyone under the age of eighty years
old
D)
E)
Whole life policies normally have a savings component that can provide
cash value on the policy.

Answers

The advantages of whole life insurance coverage over term life  insurance coverage:

its usually lasts for policyholder's entire  lifetime.its normally have a savings component that can provide  cash value on the policy.

A whole life policy is a life policy which promises to provide benefit to life assured beneficiary and usually last for the life assureds' lifetime.

The term life policy is different from whole life policy because it is a limited time insurance policy and does not incorporate main benefit enjoyed under the whole life policy

Hence, the advantages of whole life insurance coverage over term life  insurance coverage is that its lasts for policyholder's entire  lifetime and have a savings component that can provide  cash value on the policy.

In conclusion, the Option B and E is correct.

Read more about Life insurance

brainly.com/question/1373572

Can someone plz help me? :(

Answers

Answer: C

Explanation:

I'm not Hindi so I'm not sure on this, but I looked up the definition for all of the words and Artha translates to purpose/goal, which makes the most sense.

what was one of the first taxes to be levied on the colonists

Answers

Answer:

The Stamp Act

Explanation:

The Stamp Act was the first act placed on the colonies in 1765. It stated that all printed materials would have a tax on them along with a stamp to show that item had been taxed.

HELP! WILL MARK BRAINLIEST
The most common plantations in the South were ________ , ________, and _________.

Answers

Answer: cotton, tobacco, rice, and indigo.

Explanation:

hope this helps :)

Complete the quote.
While Scout shows she has been rising above the thinking of her society, she shows she is still a product of her
environment when she says of Tom, "Well Dill, after all he's
?

Answers

Answer: The answer is "Well Dill, after all he's just a Negro"

Explanation: This quote came from the daughter of the liberal-minded Atticus Finch.

what were the revolutions in the atlantic world and who were some of the leaders?

Answers

Answer:

The four revolutions addressed in this book are, in order, the American Revolution, French Revolution, Haitian Revolution, and Spanish American Revolutions throughout Latin America.

Explanation: This might not answer it but I hope that it helps!

which movement of ocean water has the greatest direct effect on the growth of producers?.

Answers

Upwelling movement of ocean water has the greatest direct effect on the growth of products.

Answer:

Upwelling movement.

Explanation:

Upwelling movement occurs when winds push surface water away from the ocean's shore and deeper water rises to fill the gap created.

During upwelling, wind-displaced surface waters are replaced by cold, nutrient-rich water that wells up from below the ocean's surface.

The upward movement of this deep, colder water is what is called upwelling which has the greatest direct effect on producers' growth.

Spanish American war
1.Why does the US get involved in the problem in Cuba?

Answers

Answer:

After the U.S. battleship Maine exploded and sank in Havana harbor under mysterious circumstances on February 15, 1898, U.S. military intervention in Cuba became likely. ... That same day, Spain declared war on the United States, and the U.S. Congress voted to go to war against Spain on April 25.

Explanation:

which event occured as a result of general cornwalls surrender at the battle of york town

Answers

After he surrendered the revolutionary war came to a end.

How did Europeans, the Japanese, and the United States gain, consolidate and maintain power in China?

Answers

Answer:

It was all based on Imperialism, they were a big nation and their army was well above others at the time. It also caused South Korea to become an Independent nation.

Explanation:

So basically they we're just stronger than everyone else, and the 3 strongest people grouped together.

Can someone plss help me with this!!!

QUESTION: Using specific examples, write 3 paragraphs of describing similarities and differences between the Columbian exchange and the exchanges that had taken place along the Silk Road trade routes of Eurasia.

Answers

Answer:

The Silk Road was a vast trade network connecting Eurasia and North Africa via land and sea routes. The Silk Road earned its name from Chinese silk, a highly valued commodity that merchants transported along these trade networks. Advances in technology and increased political stability caused an …

Explanation:

Who is Hideyoshi more concerned about becoming a Christian, domain lords, samurai, or the common people?

Answers

Answer:

In 1587, Hideyoshi issued an edict to expel the missionaries (not all Europeans). He seemed mainly concerned that too many lords were converting, and were also forcing the conversion of their retainers and subjects. There was a worry that Christian lords might have conflicting loyalties.

Explanation:

Hideyoshi is more concerned about becoming a Christian because When Hideyoshi learned that Conquistadors were following missionaries in Latin America and that missionaries were operating in the Philippines, he launched a campaign against Christianity.

Who was Hideyoshi concerned?

Hideyoshi issued an edict expelling the missionaries in 1587. (not all Europeans).

He was mostly concerned that too many lords were converting, and that they were pressing their retainers and people to convert as well.

Christian lords were suspected of having contradictory allegiance.

For more information about Hideyoshi, refer below

https://brainly.com/question/13925657

Please help! WILL MARK BRAINLIEST!
Wars end due to political, military, and economic factors. Share two examples of each factor in each category to help you remember how and why the American Revolution ended.
Political Factors:
Military Factors:
Economic Factors:

Answers

Answer:

I think may have answer

Explanation:

Political Factors: Came to an agreement

Military Factors: To many deaths

Economic Factors: Lack of money to get more supplies

All you have to do is restate it ( =

According to the "Allegory of the cave" by Plato, what is reality and what is mere illusion?

Answers

Answer:

Plato's allegory of the cave Analysis

The 'Allegory Of The Cave' is a theory put forward by Plato, concerning human perception. Plato claimed that knowledge gained through the senses is no more than opinion and that, in order to have real knowledge, we must gain it through philosophical reasoning

Explanation:

Write a brief essay explaining which constitutional issue described above you think was most serious for the country’s well-being and why.

Answers

Answer:

In 2014, the Obama administration issued guidelines for deporting unauthorized immigrants that placed the highest priority on gang members, felons and those who posed security threats. A goal was to concentrate limited resources on the most serious cases, but many Immigration and Customs Enforcement agents complained that the priorities tied their hands, taking away their discretion as to whom to pursue.

Under the new directives, the government "no longer will exempt classes or categories of removable aliens from potential enforcement." Immigration agents can now focus on picking up and removing anyone charged with or convicted of any criminal offense, even minor ones, as well as anyone already ordered deported, regardless of whether they have a criminal record.

One unauthorized immigrant in California, Kristina, who did not want her last name used because of fear of deportation, said she was alarmed to learn on Tuesday that she would now be considered a prime target. Kristina has been in the country for 25 years and has been ordered deported, but her removal had been postponed for the last four years by the Obama administration. "We have our whole lives here; our children are citizens," she said. "Now I don't know if I can go out, if I should drive."But the Obama guidelines "translated into de facto protections" for people with no legal right to live in the United States, said Dan Stein, president of the Federation for American Immigration Reform, which opposes legalization for unauthorized immigrants. Unless they fell into one of the high-priority categories, Mr. Stein said, "the chance of being deported was virtually zero."

Answer:

In 2014, the Obama administration issued guidelines for deporting unauthorized immigrants that placed the highest priority on gang members, felons and those who posed security threats. A goal was to concentrate limited resources on the most serious cases, but many Immigration and Customs Enforcement agents complained that the priorities tied their hands, taking away their discretion as to whom to pursue.

Under the new directives, the government “no longer will exempt classes or categories of removable aliens from potential enforcement.” Immigration agents can now focus on picking up and removing anyone charged with or convicted of any criminal offense, even minor ones, as well as anyone already ordered deported, regardless of whether they have a criminal record.

One unauthorized immigrant in California, Kristina, who did not want her last name used because of fear of deportation, said she was alarmed to learn on Tuesday that she would now be considered a prime target. Kristina has been in the country for 25 years and has been ordered deported, but her removal had been postponed for the last four years by the Obama administration. “We have our whole lives here; our children are citizens,” she said. “Now I don’t know if I can go out, if I should drive.”

But the Obama guidelines “translated into de facto protections” for people with no legal right to live in the United States, said Dan Stein, president of the Federation for American Immigration Reform, which opposes legalization for unauthorized immigrants. Unless they fell into one of the high-priority categories, Mr. Stein said, “the chance of being deported was virtually zero.”

How has treatment of Latinos and Native Americans changed over time? What does it look like now? Do
they have more freedoms and rights?

Answers

Answer:

Long ago Latinos and Native Americans freedom wasn't like before 1900's. First thing Christopher Columbus shouldn't be famous and the name of the day was finally changed in 2021. Plus Columbus also tortured the Native Americans. Now days, Native Americans are praised for finding this land and Columbus is now rejected.

Latinos were treated as slaves/ prisoners of The United States of America, because the border between America and Mexico. The U.S Border Patrol doesn't let them in until they got picked to resettle. For centuries they have been fed racism, ignorance and a stubborn unwillingness to understand a population who ancestors where here in millions. Before the pilgrim set foot on the land. Donald Trump back then also blocked Latino/Mexican Americans from passing the borders.  As they were called disease-ridden, two-legged bags of human debris. Also a disagreement in America about the things they done to America, by turning a lot of people into crime-ridden and drug-infested slums. Which isn't true because their is a lot of other countries that had people smuggle in drugs like heroin, etc. In most, American schools Latinos are treated equal but not for the Latinos stuck at the border. Most people are blaming Mexico for having a lot of people in America who trafficking kids that belong to American families in U.S. Around 200,000 kids a year get trafficked into s*x industry or slavery in Mexico.

Hope this helps.    

What did Thomas Jefferson and the anti-federalists require before they 2 points
agreed to ratify the Constitution?
Article 4 of the Constitution
Bill of Rights
Preamble to the Constitution
Amended Articles of Confederatioin


Answers

Answer:

Bill of rights. Srry if it's wrong

Explanation:

Mohammed unquestionably purified Judaism and in particular Christianity. Allah was a truly universal God, with no chosen people, no feelings about race
…. Likewise, Mohammed purified the worship of the One God.

— Herbert J. Muller, The Loom of History

This author most likely agrees that Islam –


A- had a greater economic impact on Europe than it did on Asia and Africa

B- was similar to the Roman Catholic Church in its reliance on priests and clergy

C- was able to expand because of beliefs shared with other pre-existing religions

D- celebrated Mohammed’s beliefs to encourage the growth of slavery in Africa

Answers

Based on what the author said, we can infer that they would most likely believe that Islam C- was able to expand because of beliefs shared with other pre-existing religions.

Herbert J. Muller believed that:

Islam was a purer form of Judaism and Christianity Islam espoused monotheism more than any other religion

This shows that Islam was related to other religions at the time that practiced similar beliefs such as Christianity and Judaism in that they were both monotheistic. The difference however, was that Islam was purer.

In conclusion, the author believed that Islam spread because it shared beliefs with other religions.

Find out more on these similarities at https://brainly.com/question/1163411.

one key change immediately following the civil war aimed at achieving the ""racial justice"" that blight describes was the

Answers

A key change that was advocated after the Civil War was the establishment of a constitutional basis for citizenship and voting rights.

Racial justice simply means a scenario where  there's no discrimination and everyone has an equal right in ten country without taking their race or religion into consideration.

A key change immediately following the civil war aimed at achieving the "racial justice" that blight describes was the establishment of a constitutional basis for citizenship and voting rights. This was vital to ensure equality for everyone.

Learn more about Civil War on:

https://brainly.com/question/24992590

Other Questions
What do you think Madison needs to include in the fire prevention training plan? Which statement best explains how the animals in the diagram contribute to the carbon cycle?AThey eat plants and other organisms that contain carbon which prevents it fromever being Stored.BThey eat plants and other organisms which contain carbon and deposit carboninto the soil when they die.They remove carbon from the atmosphere during respiration and replace it withoxygen that is used in photosynthesis.DThey remove carbon from the soil during respiration and exchange it withoxygen that evaporates into the atmosphere. Which of the following goals is NOT a focus of typical community health promotion efforts? A. Lower prescription costs B. Long-term health C. Disease prevention D. Senior citizen health Please select the best answer from the choices provided. A B C D. Lyssa and Carlos own a hardware store. They sell a certain type of light bulb in packages that each contain 24 bulbs. The back of each package says, " The expected number of broken or defective packages per bulb is 0.25" Lyssa says, "If we look at 100 packages, we expect to see a total of about 250 broken or defectve bulbs" Carlos says, "Any given package most likely contains 0.25 broken or defective bulbs".Which Statement is correct based on the expected value?A. Only LyssaB. Only CarlosC. Both Statements are correct. D. Neither Statement is correct. Marko is playing the video game fort attack. The purpose of the game is to shoot invading bandits that are trying to breach the fort's circular wall, and marko must provide the angle at which the cannon should turn in order to shoot the attacking bandits. The bandit is attacking as pictured in the figure below:. Who is Francois Mauriac and why, according to the Preface/Foreword, does he help Wieselget published? How does Mauriac describe Wiesel? Use textual evidence to support youranswer:I a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark