What is the sum of -7 1/6 + 3 5/6 in simplest form?

Answers

Answer 1

Answer:

-3 1/3

Step-by-step explanation:


Related Questions

quick!! write an equation in slope intercept form using points (-3,0) (3,-4) !

Answers

Answer:

i dunno but the slope is -4/6

Step-by-step explanation:

y=-2/3x -2 this is the slips intercept form
You do y1-y2/x2-x1 and then find the rest using y=mx+b

PLEASE ANSWER! 15 POINTS

Answers

Answer: 13/15

Step-by-step explanation:

1/5 + 2/3 = 13/15. Since 13/15 can’t be simplified, that’s your answer.

A seed company planted a floral mosaic of a national flag. The perimeter of the flag is 420 feet. Determine the​ flag's length and width if the length is 110 feet greater than the width. Use pencil and paper. Write three situations to which you could apply the resulting system of equations.
What is the length of the flag?

Answers

Answer:38

Step-by-step explanation:

15PTS PLEASE HELP ASAP!
(dont write random answers pls))

Answers

Answer:

i think the answer is (-8,-12) but i may be wrong plese correct me if  i am

Step-by-step explanation:

The obriens are buying new windows for their house. The company installs the new windows for 2100 the total cost for buying the windows and having them installed is 5323.50 of the o'briens pay 230.25 per window how many windows did they buy

Answers

Answer:

14

Step-by-step explanation:

Given that:

Cost of purchase and installation = 5323.50

Cost per window = 230.25

Cost of installation = 2100

Hence,

Total purchase cost of windows alone :

5323.50 - 2100 = 3,223.50

Therefore, the number of windows purchased is :

(Total purchase cost of windows alone / price per window)

(3,223.50 / 230.25)

= 14

Hence, 14 windows was purchased

If x to the first power is a line, and you multiply two lines together, what do you get? Think of the the exponent.

Answers

Answer: A quadratic equation (also called a parabola)

Step-by-step explanation:

A line can be written as:

f(x) = a*x + c

This is a polynomial with degree 1.

Now, of we have two lines:

f(x) = a*x + c

and:

g(x) = d*x + e

And we multiply them, we will get:

f(x)*g(x) = (a*x + c)*(d*x + e) = a*d*x^2 + a*e*x + c*d*x + c*e

We can rewrite this as:

                                           = (a*d)*x^2 + (a*e + c*d)*x + (c*e)

This is a polynomial of degree = 2, this is a quadratic equation, then if you multiply two lines together, you get a quadratic equation (or a parabola)

Answer:

ax^2+ bx + c

Step-by-step explanation:

I get a parabola, that is, an equation of the second degree

can someone help me understand this ​

Answers

Answer:

The answer for the question is E.

v=u + at
u= 2
a= -5
t = 1/2
Work out the value of v.

Answers

Answer:

V= -1/2

Step-by-step explanation:

You would have to add U+AT to get V

If A=-5 and T=1/2, then -5*1/2= -2.5 (A*T)

Then, adding U (which is 2), gives -.5, or -1/2


If a 70 kg person on a 15 kg sled is pushed with a force of 300 N, what will be person's
acceleration?

Answers


4 m/s

Explanation:
From Newton’s second Law
F = ma

a
=
F
m
=
300 N
60 kg + 15 kg
=
300 N
75 kg
=
4 m/s
2

PLEASE I NEED AN ANSWER NOW WILL MARK U BRAINLIEST!!!1!
how do u find y intercept without a graph for systems of equations? (y = x - 6)

Answers

Answer:

-6 is the y intercept.

the number added or subtracted from the x in the slope intercept form is always the y intercept

Step-by-step explanation:

plz mark me brainliest

The total cost of renting a banquet hall is a function of the number of hours the
hall is rented. The owner of the banquet hall charges $45 per half hour up to a
maximum of 5 hours and a $50 cleaning fee. The equation used to express the
situation is C = 45h + 50, where h is the number of half hours. What is the
greatest value in the range for this situation?

Answers

9514 1404 393

Answer:

  $500

Step-by-step explanation:

The greatest rental time is 5 hours, which is 10 half-hours. The value of C for h=10 is ...

  C = 45·10 +50 = 450 +50 = 500

The greatest value in the range for this situation is $500.

Find two numbers with sum 82 and difference 30.

Answers

Answer: I think it would be 112.

Step-by-step explanation:

someone please solve and find the corresponding angles thanks

Answers

the correct option is b

What is 149/15 as a mixed number?

Answers

Answer:

its an improper

mixed : 9 14/15

Step-by-step explanation:

its a mixed number if the number at the tops in the limit and there is a number at the side that represents whole number(s)

Answer:

the answer is 9 14/15

Step-by-step explanation:

Step 1 - Find Whole Number

Calculate out how many times the denominator goes into the numerator. To do that, divide 149 by 15 and keep only what is to the left of the decimal point:

149 / 15 = 9.9333 = 9

Step 2 - Find New Numerator

Multiply the answer from Step 1 by the denominator and deduct that from the original numerator.

149 - (15 x 9) = 14

Step 3 - Get Solution

Keep the original denominator and use the answers from Step 1 and Step 2 to get the answer. 149/15 as a mixed number is:

Lines MN and PQ are parallel. Lines RS and TV intersect them. Which statements are true about these lines? Select three options. The slope of line MN is Two-thirds. The slope of line PQ is undefined. The slope of line RS is Negative three-halves. Lines RS and TV are parallel. Line RS is perpendicular to both line MN and line PQ.

Answers

Answer:

hello your question is incomplete attached below is the missing diagram

answer :

RS is perpendicular to line  MN and line PQ  

The slope of line MN is 2/3

The slope of line RS is  -3/2

Step-by-step explanation:

The slope of line MN is 2/3

slope of MN = [tex]\frac{3-(-1)}{3-(-3)}[/tex]  =  4/6 =  2/3

The slope of line RS is  -3/2

slope of RS = [tex]\frac{-2-1}{2-0}[/tex] = -3/2  this shows that Line RS are perpendicular

Lines RS is perpendicular  to MN and PQ

 lines RS is perpendicular to MN and PQ because it's sign is opposite hence it is perpendicular to MN and PQ

Answer:

The slope of line MN is Two-thirds.

The slope of line RS is Negative three-halves.

Line RS is perpendicular to both line MN and line PQ.

Step-by-step explanation:

hope it helps

I need help one this question.

Answers

Answer:

-2

Step-by-step explanation:

the y-intercept is -2

Answer:

y=2x-2

Step-by-step explanation:

Find the slope.

y1-y2/x1-x2

2-(-2)/2-0

That gives you 4/2 or a slope of 2.

The y intercept is at -2.

Y=2x-2

Which table does NOT show y as a function of x?

Answers

Answer:

C

Step-by-step explanation:

I don’t really know what to say haha, it’s easy

please help me i don’t understand how to do this

Answers

what do u need help with?

can someone answer the questions on my page if so ill give all the correct answers brainlist.

Answers

Oh okay that’s a bet

How do I solve this equation by completing the square. 4X^2 + 12x +5 = 21

Answers

The Answer is: x1=-4 x2=1.

In a football stadium, 43% of the crowd cheering for Team A, and 52% of the crowd is female. 19% of the crowd is cheering for Team A and female . What is the probability that a randomly selected Person from the crowd are cheering for Team A or female?

Answers

P(TeamA) = 0,43
P(Female) = 0,52
P(TeamA and Female) = 0,19
P(TeamA or Female) = ?

P(TeamA or Female) = P(TeamA) + P(Female) - P(TeamA and Female) <=>

P(TeamA or Female) = 0,43 + 0,52 - 0,19 <=>

P(TeamA or Female) = 0,76 or 76%

The value of the digit in the hundreds place in the number 587,349 is 1/10 the value of the digit in the thousands place in which number? *

Answers

Answer:

3000 is your answer

Step-by-step explanation:

The 3 in the hundreds place if the number 587,349 has a value of 300. This 300 is 1/10 the value of the number you're looking for, so if x is the number you're looking for, then

[tex]300 = \frac{1}{10} x[/tex]

[tex]300 \times 10 = \frac{1}{10} x \times 10[/tex]

[tex]3000 = x[/tex]

x is your answer.

y = m + mnp
Solve for n.
pls help me

Answers

Answer:

n = y - m/mp

Step-by-step explanation:

y = m + mnp

y - m = mnp

y - m/mp = mnp/mp

y - m/mp = n

can you please help me with this​

Answers

Answer:

Dot plot

Step-by-step explanation:

Each dot on on 0.84 represents each plane. 5 planes had a average cruising speed of 0.84.

Pls help fast will give brainliest

Answers

Answer:

23

Step-by-step explanation:

6×3+5(3-2)

6×3+5×1

18+5

23

Even if you don’t think it is an independent variable, _____ is usually always plotted on the “x” axis.


Help?

Answers

Answer:

Y axis is dependent

Step-by-step explanation:

and x axis is independent, so if its on the x axis, its alwasy a independent variable, hope it helped Lol


write each percent as a fraction in simplest form
60%​

Answers

Answer: 3/5 i hope this helps god bless

Step-by-step explanation:

Which value of x makes the equation x + 7 = 21 true?
O A. 7
O B. 14
O c. 21
OD. 28

Answers

Answer:

b. 14

Step-by-step explanation:

I need help with this​

Answers

Answer:

24.3470022334

Step-by-step explanation:

I hope this helps. It really isn’t too hard. All you need to do is find the multiples of 24

transversals angles​

Answers

B. 2 because it is inside and on the same side as 1
Other Questions
pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters?