Whoever answers gets brainlist!

Whoever Answers Gets Brainlist!

Answers

Answer 1

Answer:

B

Step-by-step explanation:

Answer 2

Answer:

The height is 4 Ft.

Step-by-step explanation:

9*4=36

9 ft*4 ft=36 Ft.

Hope this helps


Related Questions

Find the value of x. 15 30 120 60

Answers

Answer:  There isnt a question here

Step-by-step explanation:

Use a power-reducing formula to rewrite the given expression in terms of the first power of the cosine:
tan^2(8x)

Answers

tan²(8x) = sin²(8x) / cos²(8x)

… = (1 - cos²(8x)) / cos²(8x)

… = 1 / cos²(8x) - 1

… = 2 / (1 + cos(16x)) - 1

where the last equality follows from the half-angle identity for cosine,

cos²(x) = (1 + cos(2x)) / 2

Karim Corp. requires a minimum $8,600 cash balance. Loans taken to meet this requirement cost 1% interest per month (paid monthly). Any excess cash is used to repay loans at month-end. The cash balance on July 1 is $9,000, and the company has no outstanding loans. Forecasted cash receipts (other than for loans received) and forecasted cash payments (other than for loan or interest payments) follow.

Answers

Answer:

Step-by-step explanation:

Karim Corp. requires a minimum $8,600 cash balance. Loans taken to meet this requirement cost 1% interest per month (paid monthly). Any excess cash is used to repay loans at month-end. The cash balance on July 1 is $9,000, and the company has no outstanding loans. Forecasted cash receipts (other than for loans received) and forecasted cash payments (other than for loan or interest payments) follow. Cash receipts Cash payments July $ 24,600 28,900 August $32,600 30,600 September $ 40,600 32,600 Prepare a cash budget for July, August, and September. (Negative balances and Loan repayment amounts (if any) should be indicated with minus sign. Round your final answers to the nearest whole dollar.) KARIM CORP. Cash Budget For July, August, and September July August $ 9,000 September Beginning cash balance Total cash available Preliminary cash balance Ending cash balance Loan balance $ 0 Loan balance - Beginning of month Additional loan (loan repayment) Loan balance - End of month

Expression vs Equations

Answers

Answer:

20

Step-by-step explanation:

An expression dose NOT have an = sign

An equation dose have an = sign

In this case, the expression 4x+8, replace the x with 3, since x=3

                                  4x + 8

                                4 x 3 + 8         (  don't forget  PEMDAS )

                                  12  + 8

                                     20

So, X=8 right?
4x+8
Now, if we replace x with 8, we get 4(8) + 8. Now, the first think you do is multiply. So, 4(8) = 32. We now have 32+8, since we fixed the left part. Now, all you have to do is add 32+8, and you get 40.
Hope this helps!

Rachel is pouring a concrete patio. Her patio will be 6 inches deep, 6 feet long and 8 feet wide. If she rounds up to the nearest hundredth, how many cubic yards of concrete will she need? (Remember, yd3=in3÷46,656 )

Answers

Answer:

2.6667yd^3

Step-by-step explanation

Volume of the concrete = Length * width * height

Given

height = 6 inches

To yards;

1 in = 0.0277778yd

6 in = 6 * 0.0277778

6in = 0.1666668 yards

Width = 8 feet

Length = 6ft

LW = 48ft²

To yards;

1 ft = 0.333333yd

48 ft = 48(0.333333)

48 ft^ 2 = 15.999984yd^2

Volume = 15.999984 * 0.1666668

Volume = 2.6667 yd^3

Hence she will need 2.6667yd^3 concrete

For what value of x is L ll m

Answers

Answer:

x = 89

Step-by-step explanation:

3x - 18 + 105 = 180

3x - 87 = 180

    + 87     + 87

3x = 267

/ 3     / 3

x = 89

You have measured the systolic blood pressure of a random sample of 25 employees of a company located near you. A 95% confidence interval for the menu systolic blood pressure for the employees of this company is (122, 138). Which of the following statements gives a valid interpretation of the confidence level?a. 95% of the sample of employees have a systolic blood pressure between 122 and 138.b. 95% of tire population of employees have a systolic blood pressure between 122 and 138c. If the procedure were repeated many times, 95% of the resulting confidence intervals would contain the population means systolic blood pressure.d. The probability that the population mean blood pressure is between 122 and 138 is .95

Answers

I have 0 idea sorry

What is the GCF of 15 and 60

Answers

Answer:

15

answer is 15 oooooooooooooooooooooooyup

What is 1400 x 3278
i need help

Answers

Answer:

4,589,200

Step-by-step explanation:

Answer:

4589200

Step-by-step explanation:

hope this helps!! :D

NEED ANSWER ASAP- FINALS
Which type of function best models the data in the table? Use differences or ratios.

Choose the correct answer below.
• Exponential model
• Linear model
• None
• Quadratic model

Answers

An exponential model would work best. There is no constant rate of increase, ruling out a linear model. Additionally, there is not increasing-decreasing trend between the y values, ruling out a quadratic model. There is a considerable increase in the units it takes to transition from one unit of x to another unit of x. For example, going from x = 1 to x = 2, it takes 16.5 units. However, when going from x = 2 to x = 3, it takes 27.5 units. This difference in numbers keeps increasing exponentially, not at a constant rate, therefore an exponential model would work best.
I have been overthinking this and it’s none

anyone nervous about semester exams

Answers

Answer:

YES

Step-by-step explanation:

I am literally trying to fit in as much studying as possible but I keep getting distracted ;-;

How to Convert 5 over 16 to decimal​

Answers

Answer:

Step-by-step explanation:

Sorry for the shadow.

A cookie recipe asks for 5 cups of sugar for every 25 cookies
made. How much sugar is used per cookie?

Answers

Answer:

0.2 cups of sugar

Step-by-step explanation:

Make a proportion:

5 cups / 25 cookies = x cups / 1 cookie ---> 0.2

Answer:

I'm verrry sorry if i get it wrong plz forgive me if it is but here is my hypothesis.

Step-by-step explanation:

You just divide 5 by 25 which would be 0.2 and so it would be 0.2:1 or 0.2 per cookie

plz mark me brainliest!

Question 1) In an auditorium, there are 22 seats in the first row and 28 seats in the second row. The number of seats in a row continues to increase by 6 with each additional row. A) Write an iterative rule to model the sequence formed by the number of seats in each row. Show your work. (B) Use the rule to determine which row has 100 seats. Show your work. ( No Plagiarism and only answer if you know how to work this problem out. Will Mark Brainliest).​

Answers

Answer:

Please Mark as Brainliest!!!!!!

Step-by-step explanation

In an auditorium, there are 21 seats in the first row and 29 seats in the second row. The number of seats in a row continues to increase by 8 with each additional row. How would you find the 100th row?

We can take this as an arithmetic sequence, as the seats in next row is calculated by adding 8 to previous row

So here common difference will be 8

the first term is 21

the arithmetic sequence is given by:

Putting the values of a1 and d

for 100th row,

Putting n=100

3. The sequence 6, 18, 54, 162, … shows the number of pushups Kendall did each week, starting with her first week of exercising.

Give the rule you would use to find the 20th week.

Given sequence is:

6, 18, 54, 162, …

we can see that the common difference is not same so we will find the common ratio

The given sequence is a geometric sequence as are the same for consecutive terms

The geometric sequence is given by:

Hence,

2. Seats in 100th Row = 813

3. Rule is:

Keywords: Sequence, ratio

Answer:

see explanation

Step-by-step explanation:

The sequence is

22, 28, 34, ....

Since there is a common difference of 6 the sequence is arithmetic with n th term

[tex]a_{n}[/tex] = a₁ + (n - 1)d

a₁ is the first term and d the common difference

Here a₁ = 22 and d = 6, then

[tex]a_{n}[/tex] = 22 + 6(n - 1) = 22 + 6n - 6 = 6n + 16

Equate to 100 and solve for n

6n + 16 = 100 ( subtract 16 from both sides )

6n = 84 ( divide both sides by 6 )

n = 14

Thus the 14 th row has 100 seats

write 4/7 as a percentage, to 2 decimal places.


Please help!

Answers

Answer:

57.14%

Step-by-step explanation:

To convert any fraction to a percentage you need to multiply it by 100

So,

4/7*100= 57.14 (round it off to two decimal places as the question states)

What are the two methods for finding the constant of proportionality when given a table

Answers

Answer:

If the ratio of one variable to the other is constant, then the two variables have a proportional relationship, If x and y have a proportional relationship, the constant of proportionality is the ratio of y to x.

Step-by-step explanation:

A wire 4 1/2 feet long is being cut into smaller pieces of wire, each 11/4 feet long. What is the maximum number of the smaller pieces of wire that can be cut from the original piece of wire?

Answers

Answer:

1

Step-by-step explanation:

Take 4 1/2 and turn it into just halves by multiplying 4•2 and then adding it to one. 9/2 then multiply that by 2 because you need the denominator to be 4 getting 18/4. Then subtract 11/4 you end up getting 9/4. So technically you have 2 pieces but if you want them both to be 11/4 you only have one

What is the solution to the system of equations?

Answers

Answer:

a

Step-by-step explanation:

a

3x-4+7x-8-10x-2

Simplify

Answers

Answer:

The answer is -14

Step-by-step explanation:

P.S Can I have brainliest?

x + 5y = 8
3x = 24 - 157

Answers

Answer:

x = [tex]-\frac{133}{3}[/tex], y = [tex]\frac{157}{15}[/tex]

Step-by-step explanation:

x + 5y = 8

3x = 24 - 157

3x = 24 - 157

3x = -133

x = [tex]-\frac{133}{3}[/tex]

x + 5y = 8

[tex]-\frac{133}{3}[/tex] + 5y = 8

5y = [tex]\frac{157}{3}[/tex]

y = [tex]\frac{157}{15}[/tex]

A chicken farmer started his summer with 6
chickens. By fall, he counted 36 chickens,
and by
winter he counted 216 chickens Which expression
represents the number of chickens he had by
winter?
Need help asap!

Answers

Answer: It is multiplying by 6 each time

(b) x - 4x2 + x + 6​

Answers

Answer:

bx-4x^2+x+6

Step-by-step explanation:

A company that makes cola drinks states that the mean caffeine content per 12-ounce bottle of cola 40 milligrams. You want to test this claim. During your tests, you find that a random sample of thirty 12-ounce bottles of cola has a mean caffeine content of 39.2 milligrams. Assume the population is normally distributed with a standard deviation of 7.5 milligrams. At α=0.01, can you reject the company’s claim

Answers

Answer:

Claim cannot be rejected

Step-by-step explanation:

We solve this by using hypothesis testing

H0: mean = 40

H1: mean ≠ 40

We have samples of 30, but we were not gives the population standard deviation. We used the t distribution

T score = 39.2-40/(7.5/√30)

= -0.5842

Degree of freedom = 30-1 = 29

Then p value = 0.5636

In conclusion, we fail to reject the null hypothesis since 0.5636 > 0.01 significance level.

So company's claim cannot be rejected

Helllppppppppppppppppp

Answers

Answer:

B) 5

Step-by-step explanation:

a(x)=1/9(90-x)

x=45

1/9(90-45)

1/9(45)

5

Hope this helps plz hit the crown :D

Answer:

The value of h(45) ⇨ 5  | B Choice.

Step-by-step explanation:

[tex]h(x)=\frac{1}{9}(90-x)[/tex]

⟺ Find the value of h(45), substitute x = 45 in h(x)

[tex]h(45) = \frac{1}{9}(90-45)\\h(45)=\frac{1}{9}(45)\\h(45)=5[/tex]

Thus, the answer is 5.

Holly is painting her garage. She estimates it will take her
4.5 hours to complete the job. Her brother Jasper offers to help and can paint at half the rate Holly paints. About how many hours should it take for both siblings to complete the job?

Answers

Answer:

3

Step-by-step explanation:

Using the work rate formula (1/Holly's time) + (1/Jasper's time which is twice of Holly's time) = 1/ Total time taken by both

I’ll mark brainliest please help with all and leave a small explanation! :)

Answers

Answer:

A y=6 x= 3

B y=4 x= 2

C y=6 x= 2

D x= 4 y= -2

Step-by-step explanation:

you need to add the numbers on and look how many once u do thag u can see the pattern it makes

Lauren saves 30% of her paycheck to purchase the IPhone 12. She earns $325 per paycheck. How much will Lauren have for her IPhone if she has saved from two paychecks?

Answers

Answer:

$195

Step-by-step explanation:

30% of one paycheck = (30/100) x $325 = $97.5

30% of two paychecks = $97.5 x 2 = $195

If the store paid $75 for a clarinet and sold it for $100, did the store mark up the price by 30%?

Answers

Answer:

No

Step-by-step explanation:

30% of $75 is $22.50 (0.3×75=22.5)

$75+$22.50=$97.50, not $100

So, the store did not mark up the price by 30% because the original price ($75) plus 30% more does not equal $100.

Answer:

no

Step-by-step explanation:

LAST ONE !!! Ok here

Answers

Answer:

Market economy

Step-by-step explanation:

Once again this is because they are changing their prices and items for sale because of the changes in market.

3. Given that f(x) = 1/ax - 3 and f(x)^-1 = 2x – 6b.
a. Find the values of a and b. ​

Answers

Answer:

a = 2, b = -1

Step-by-step explanation:

type the formula into desmos and adjust the sliders until you have a symmetrical pattern

Other Questions
Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False